\
| Variant ID: vg1009407594 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9407594 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 96. )
ATTTACATAAAATATCCTAACTAATAGATACAATTGCCTTCCCAGGACTCTATCTATGCGTGGCAATAATCTTGAAGTACATTAACTTGAACCCGATGTC[G/A]
CGTACAAGTCGTATTGTCGGAATCGGCTATATCGGCTTATTTATCTCAACTCAGACTCAGCCTATCCTAACCGTAGCCGATCCGGACTCCAGCCGATTCC
GGAATCGGCTGGAGTCCGGATCGGCTACGGTTAGGATAGGCTGAGTCTGAGTTGAGATAAATAAGCCGATATAGCCGATTCCGACAATACGACTTGTACG[C/T]
GACATCGGGTTCAAGTTAATGTACTTCAAGATTATTGCCACGCATAGATAGAGTCCTGGGAAGGCAATTGTATCTATTAGTTAGGATATTTTATGTAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.60% | 45.60% | 0.47% | 3.32% | NA |
| All Indica | 2759 | 43.00% | 56.30% | 0.62% | 0.07% | NA |
| All Japonica | 1512 | 60.10% | 30.40% | 0.13% | 9.33% | NA |
| Aus | 269 | 63.90% | 35.30% | 0.74% | 0.00% | NA |
| Indica I | 595 | 27.60% | 71.30% | 1.01% | 0.17% | NA |
| Indica II | 465 | 61.10% | 38.50% | 0.43% | 0.00% | NA |
| Indica III | 913 | 39.60% | 60.00% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 48.00% | 51.10% | 0.76% | 0.13% | NA |
| Temperate Japonica | 767 | 68.80% | 19.90% | 0.13% | 11.08% | NA |
| Tropical Japonica | 504 | 53.20% | 45.60% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 46.90% | 32.00% | 0.41% | 20.75% | NA |
| VI/Aromatic | 96 | 64.60% | 22.90% | 0.00% | 12.50% | NA |
| Intermediate | 90 | 68.90% | 27.80% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009407594 | G -> A | LOC_Os10g18550.1 | upstream_gene_variant ; 450.0bp to feature; MODIFIER | silent_mutation | Average:25.176; most accessible tissue: Minghui63 flag leaf, score: 33.603 | N | N | N | N |
| vg1009407594 | G -> A | LOC_Os10g18540.1 | downstream_gene_variant ; 2296.0bp to feature; MODIFIER | silent_mutation | Average:25.176; most accessible tissue: Minghui63 flag leaf, score: 33.603 | N | N | N | N |
| vg1009407594 | G -> A | LOC_Os10g18560.1 | downstream_gene_variant ; 4523.0bp to feature; MODIFIER | silent_mutation | Average:25.176; most accessible tissue: Minghui63 flag leaf, score: 33.603 | N | N | N | N |
| vg1009407594 | G -> A | LOC_Os10g18540-LOC_Os10g18550 | intergenic_region ; MODIFIER | silent_mutation | Average:25.176; most accessible tissue: Minghui63 flag leaf, score: 33.603 | N | N | N | N |
| vg1009407594 | G -> DEL | N | N | silent_mutation | Average:25.176; most accessible tissue: Minghui63 flag leaf, score: 33.603 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009407594 | 5.12E-06 | 3.62E-06 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009407594 | 6.70E-06 | NA | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009407594 | 1.03E-06 | 1.03E-06 | mr1110 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009407594 | 3.49E-07 | 8.62E-07 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009407594 | NA | 1.87E-08 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009407594 | NA | 1.22E-09 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009407594 | 9.93E-08 | 2.66E-08 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009407594 | 3.79E-06 | NA | mr1070_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009407594 | 1.76E-06 | 4.05E-06 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009407594 | 2.99E-07 | 5.39E-07 | mr1147_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009407594 | NA | 9.26E-06 | mr1204_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009407594 | 5.98E-06 | 5.71E-06 | mr1264_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009407594 | NA | 1.62E-08 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |