Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1009407594:

Variant ID: vg1009407594 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9407594
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTACATAAAATATCCTAACTAATAGATACAATTGCCTTCCCAGGACTCTATCTATGCGTGGCAATAATCTTGAAGTACATTAACTTGAACCCGATGTC[G/A]
CGTACAAGTCGTATTGTCGGAATCGGCTATATCGGCTTATTTATCTCAACTCAGACTCAGCCTATCCTAACCGTAGCCGATCCGGACTCCAGCCGATTCC

Reverse complement sequence

GGAATCGGCTGGAGTCCGGATCGGCTACGGTTAGGATAGGCTGAGTCTGAGTTGAGATAAATAAGCCGATATAGCCGATTCCGACAATACGACTTGTACG[C/T]
GACATCGGGTTCAAGTTAATGTACTTCAAGATTATTGCCACGCATAGATAGAGTCCTGGGAAGGCAATTGTATCTATTAGTTAGGATATTTTATGTAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.60%	45.60%	0.47%	3.32%	NA
All Indica	2759	43.00%	56.30%	0.62%	0.07%	NA
All Japonica	1512	60.10%	30.40%	0.13%	9.33%	NA
Aus	269	63.90%	35.30%	0.74%	0.00%	NA
Indica I	595	27.60%	71.30%	1.01%	0.17%	NA
Indica II	465	61.10%	38.50%	0.43%	0.00%	NA
Indica III	913	39.60%	60.00%	0.33%	0.00%	NA
Indica Intermediate	786	48.00%	51.10%	0.76%	0.13%	NA
Temperate Japonica	767	68.80%	19.90%	0.13%	11.08%	NA
Tropical Japonica	504	53.20%	45.60%	0.00%	1.19%	NA
Japonica Intermediate	241	46.90%	32.00%	0.41%	20.75%	NA
VI/Aromatic	96	64.60%	22.90%	0.00%	12.50%	NA
Intermediate	90	68.90%	27.80%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009407594	G -> A	LOC_Os10g18550.1	upstream_gene_variant ; 450.0bp to feature; MODIFIER	silent_mutation	Average:25.176; most accessible tissue: Minghui63 flag leaf, score: 33.603	N	N	N	N
vg1009407594	G -> A	LOC_Os10g18540.1	downstream_gene_variant ; 2296.0bp to feature; MODIFIER	silent_mutation	Average:25.176; most accessible tissue: Minghui63 flag leaf, score: 33.603	N	N	N	N
vg1009407594	G -> A	LOC_Os10g18560.1	downstream_gene_variant ; 4523.0bp to feature; MODIFIER	silent_mutation	Average:25.176; most accessible tissue: Minghui63 flag leaf, score: 33.603	N	N	N	N
vg1009407594	G -> A	LOC_Os10g18540-LOC_Os10g18550	intergenic_region ; MODIFIER	silent_mutation	Average:25.176; most accessible tissue: Minghui63 flag leaf, score: 33.603	N	N	N	N
vg1009407594	G -> DEL	N	N	silent_mutation	Average:25.176; most accessible tissue: Minghui63 flag leaf, score: 33.603	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009407594	5.12E-06	3.62E-06	mr1053	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594	6.70E-06	NA	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594	1.03E-06	1.03E-06	mr1110	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594	3.49E-07	8.62E-07	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594	NA	1.87E-08	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594	NA	1.22E-09	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594	9.93E-08	2.66E-08	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594	3.79E-06	NA	mr1070_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594	1.76E-06	4.05E-06	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594	2.99E-07	5.39E-07	mr1147_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594	NA	9.26E-06	mr1204_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594	5.98E-06	5.71E-06	mr1264_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594	NA	1.62E-08	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251