\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009407594:

Variant ID: vg1009407594 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9407594
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTACATAAAATATCCTAACTAATAGATACAATTGCCTTCCCAGGACTCTATCTATGCGTGGCAATAATCTTGAAGTACATTAACTTGAACCCGATGTC[G/A]
CGTACAAGTCGTATTGTCGGAATCGGCTATATCGGCTTATTTATCTCAACTCAGACTCAGCCTATCCTAACCGTAGCCGATCCGGACTCCAGCCGATTCC

Reverse complement sequence

GGAATCGGCTGGAGTCCGGATCGGCTACGGTTAGGATAGGCTGAGTCTGAGTTGAGATAAATAAGCCGATATAGCCGATTCCGACAATACGACTTGTACG[C/T]
GACATCGGGTTCAAGTTAATGTACTTCAAGATTATTGCCACGCATAGATAGAGTCCTGGGAAGGCAATTGTATCTATTAGTTAGGATATTTTATGTAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.60% 45.60% 0.47% 3.32% NA
All Indica  2759 43.00% 56.30% 0.62% 0.07% NA
All Japonica  1512 60.10% 30.40% 0.13% 9.33% NA
Aus  269 63.90% 35.30% 0.74% 0.00% NA
Indica I  595 27.60% 71.30% 1.01% 0.17% NA
Indica II  465 61.10% 38.50% 0.43% 0.00% NA
Indica III  913 39.60% 60.00% 0.33% 0.00% NA
Indica Intermediate  786 48.00% 51.10% 0.76% 0.13% NA
Temperate Japonica  767 68.80% 19.90% 0.13% 11.08% NA
Tropical Japonica  504 53.20% 45.60% 0.00% 1.19% NA
Japonica Intermediate  241 46.90% 32.00% 0.41% 20.75% NA
VI/Aromatic  96 64.60% 22.90% 0.00% 12.50% NA
Intermediate  90 68.90% 27.80% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009407594 G -> A LOC_Os10g18550.1 upstream_gene_variant ; 450.0bp to feature; MODIFIER silent_mutation Average:25.176; most accessible tissue: Minghui63 flag leaf, score: 33.603 N N N N
vg1009407594 G -> A LOC_Os10g18540.1 downstream_gene_variant ; 2296.0bp to feature; MODIFIER silent_mutation Average:25.176; most accessible tissue: Minghui63 flag leaf, score: 33.603 N N N N
vg1009407594 G -> A LOC_Os10g18560.1 downstream_gene_variant ; 4523.0bp to feature; MODIFIER silent_mutation Average:25.176; most accessible tissue: Minghui63 flag leaf, score: 33.603 N N N N
vg1009407594 G -> A LOC_Os10g18540-LOC_Os10g18550 intergenic_region ; MODIFIER silent_mutation Average:25.176; most accessible tissue: Minghui63 flag leaf, score: 33.603 N N N N
vg1009407594 G -> DEL N N silent_mutation Average:25.176; most accessible tissue: Minghui63 flag leaf, score: 33.603 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009407594 5.12E-06 3.62E-06 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594 6.70E-06 NA mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594 1.03E-06 1.03E-06 mr1110 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594 3.49E-07 8.62E-07 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594 NA 1.87E-08 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594 NA 1.22E-09 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594 9.93E-08 2.66E-08 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594 3.79E-06 NA mr1070_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594 1.76E-06 4.05E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594 2.99E-07 5.39E-07 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594 NA 9.26E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594 5.98E-06 5.71E-06 mr1264_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009407594 NA 1.62E-08 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251