\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009362967:

Variant ID: vg1009362967 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9362967
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGATCAAAACTCAACAAACTCCACCTTGAGACAAATTCCTTCTTGTAGTATGAATCAATCCTTCACCCTAAACACAACAAAGACAAAAAAACACTTTCGG[C/T]
GCCAAATAGCCTCTCAGGCTAAACCACTATACCAACTAAGCTTGAGCAAAGCTCAAACTTAGCAACAGTTTCAGACTTTGTCATCATATCAGCAGGATTA

Reverse complement sequence

TAATCCTGCTGATATGATGACAAAGTCTGAAACTGTTGCTAAGTTTGAGCTTTGCTCAAGCTTAGTTGGTATAGTGGTTTAGCCTGAGAGGCTATTTGGC[G/A]
CCGAAAGTGTTTTTTTGTCTTTGTTGTGTTTAGGGTGAAGGATTGATTCATACTACAAGAAGGAATTTGTCTCAAGGTGGAGTTTGTTGAGTTTTGATCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.50% 0.80% 1.35% 20.33% NA
All Indica  2759 70.60% 1.10% 2.17% 26.10% NA
All Japonica  1512 85.40% 0.30% 0.26% 14.09% NA
Aus  269 98.50% 0.00% 0.00% 1.49% NA
Indica I  595 78.20% 0.20% 0.67% 21.01% NA
Indica II  465 55.50% 2.20% 5.38% 36.99% NA
Indica III  913 75.00% 1.40% 1.53% 22.02% NA
Indica Intermediate  786 68.70% 0.90% 2.16% 28.24% NA
Temperate Japonica  767 87.90% 0.00% 0.00% 12.13% NA
Tropical Japonica  504 85.70% 0.00% 0.40% 13.89% NA
Japonica Intermediate  241 76.80% 1.70% 0.83% 20.75% NA
VI/Aromatic  96 83.30% 4.20% 0.00% 12.50% NA
Intermediate  90 85.60% 1.10% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009362967 C -> T LOC_Os10g18430.1 upstream_gene_variant ; 4247.0bp to feature; MODIFIER silent_mutation Average:25.122; most accessible tissue: Callus, score: 46.827 N N N N
vg1009362967 C -> T LOC_Os10g18410.1 downstream_gene_variant ; 495.0bp to feature; MODIFIER silent_mutation Average:25.122; most accessible tissue: Callus, score: 46.827 N N N N
vg1009362967 C -> T LOC_Os10g18420.1 downstream_gene_variant ; 136.0bp to feature; MODIFIER silent_mutation Average:25.122; most accessible tissue: Callus, score: 46.827 N N N N
vg1009362967 C -> T LOC_Os10g18410-LOC_Os10g18420 intergenic_region ; MODIFIER silent_mutation Average:25.122; most accessible tissue: Callus, score: 46.827 N N N N
vg1009362967 C -> DEL N N silent_mutation Average:25.122; most accessible tissue: Callus, score: 46.827 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009362967 9.03E-15 3.43E-45 mr1039 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009362967 8.72E-09 1.10E-30 mr1039 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009362967 4.43E-12 NA mr1632 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009362967 8.16E-11 1.97E-16 mr1632 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009362967 6.02E-15 1.07E-38 mr1039_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009362967 2.19E-10 4.96E-24 mr1039_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009362967 1.23E-07 NA mr1514_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009362967 1.80E-07 4.00E-08 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009362967 NA 7.72E-06 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009362967 9.75E-15 2.92E-32 mr1632_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009362967 7.59E-12 6.13E-23 mr1632_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251