\
| Variant ID: vg1009362967 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9362967 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGATCAAAACTCAACAAACTCCACCTTGAGACAAATTCCTTCTTGTAGTATGAATCAATCCTTCACCCTAAACACAACAAAGACAAAAAAACACTTTCGG[C/T]
GCCAAATAGCCTCTCAGGCTAAACCACTATACCAACTAAGCTTGAGCAAAGCTCAAACTTAGCAACAGTTTCAGACTTTGTCATCATATCAGCAGGATTA
TAATCCTGCTGATATGATGACAAAGTCTGAAACTGTTGCTAAGTTTGAGCTTTGCTCAAGCTTAGTTGGTATAGTGGTTTAGCCTGAGAGGCTATTTGGC[G/A]
CCGAAAGTGTTTTTTTGTCTTTGTTGTGTTTAGGGTGAAGGATTGATTCATACTACAAGAAGGAATTTGTCTCAAGGTGGAGTTTGTTGAGTTTTGATCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.50% | 0.80% | 1.35% | 20.33% | NA |
| All Indica | 2759 | 70.60% | 1.10% | 2.17% | 26.10% | NA |
| All Japonica | 1512 | 85.40% | 0.30% | 0.26% | 14.09% | NA |
| Aus | 269 | 98.50% | 0.00% | 0.00% | 1.49% | NA |
| Indica I | 595 | 78.20% | 0.20% | 0.67% | 21.01% | NA |
| Indica II | 465 | 55.50% | 2.20% | 5.38% | 36.99% | NA |
| Indica III | 913 | 75.00% | 1.40% | 1.53% | 22.02% | NA |
| Indica Intermediate | 786 | 68.70% | 0.90% | 2.16% | 28.24% | NA |
| Temperate Japonica | 767 | 87.90% | 0.00% | 0.00% | 12.13% | NA |
| Tropical Japonica | 504 | 85.70% | 0.00% | 0.40% | 13.89% | NA |
| Japonica Intermediate | 241 | 76.80% | 1.70% | 0.83% | 20.75% | NA |
| VI/Aromatic | 96 | 83.30% | 4.20% | 0.00% | 12.50% | NA |
| Intermediate | 90 | 85.60% | 1.10% | 0.00% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009362967 | C -> T | LOC_Os10g18430.1 | upstream_gene_variant ; 4247.0bp to feature; MODIFIER | silent_mutation | Average:25.122; most accessible tissue: Callus, score: 46.827 | N | N | N | N |
| vg1009362967 | C -> T | LOC_Os10g18410.1 | downstream_gene_variant ; 495.0bp to feature; MODIFIER | silent_mutation | Average:25.122; most accessible tissue: Callus, score: 46.827 | N | N | N | N |
| vg1009362967 | C -> T | LOC_Os10g18420.1 | downstream_gene_variant ; 136.0bp to feature; MODIFIER | silent_mutation | Average:25.122; most accessible tissue: Callus, score: 46.827 | N | N | N | N |
| vg1009362967 | C -> T | LOC_Os10g18410-LOC_Os10g18420 | intergenic_region ; MODIFIER | silent_mutation | Average:25.122; most accessible tissue: Callus, score: 46.827 | N | N | N | N |
| vg1009362967 | C -> DEL | N | N | silent_mutation | Average:25.122; most accessible tissue: Callus, score: 46.827 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009362967 | 9.03E-15 | 3.43E-45 | mr1039 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009362967 | 8.72E-09 | 1.10E-30 | mr1039 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009362967 | 4.43E-12 | NA | mr1632 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009362967 | 8.16E-11 | 1.97E-16 | mr1632 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009362967 | 6.02E-15 | 1.07E-38 | mr1039_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009362967 | 2.19E-10 | 4.96E-24 | mr1039_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009362967 | 1.23E-07 | NA | mr1514_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009362967 | 1.80E-07 | 4.00E-08 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009362967 | NA | 7.72E-06 | mr1536_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009362967 | 9.75E-15 | 2.92E-32 | mr1632_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009362967 | 7.59E-12 | 6.13E-23 | mr1632_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |