\
| Variant ID: vg1009351636 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr10 | Position: 9351636 |
| Reference Allele: GATTCTTGATATTTCTAACCAATGCATGAAACAAAGTAGTATAATCGAA | Alternative Allele: G,CATTCTTGATATTTCTAACCAATGCATGAAACAAAGTAGTATAATCGAA |
| Primary Allele: GATTCTTGATATTTCTAACC AATGCATGAAACAAAGTAGT ATAATCGAA | Secondary Allele: CATTCTTGATATTTCTAACC AATGCATGAAACAAAGTAGT ATAATCGAA |
Inferred Ancestral Allele: Not determined.
CCATGTATATTATTTAGATGAATTAAGCTTAGTTTATACATCCTTATATTCCTTGCGTATAGATCGCAGTATCGCTACTTGTAGCTTATTTTGCAAACCC[GATTCTTGATATTTCTAACCAATGCATGAAACAAAGTAGTATAATCGAA/G,CATTCTTGATATTTCTAACCAATGCATGAAACAAAGTAGTATAATCGAA]
ATTCTTGATATTTCTAACCAATGCATGAAACAAAGTAGTATAATATATGCCATCTCCTACGATGGGTCATATAGAAGTGACTATATATTCAAACTAAGAA
TTCTTAGTTTGAATATATAGTCACTTCTATATGACCCATCGTAGGAGATGGCATATATTATACTACTTTGTTTCATGCATTGGTTAGAAATATCAAGAAT[TTCGATTATACTACTTTGTTTCATGCATTGGTTAGAAATATCAAGAATC/C,TTCGATTATACTACTTTGTTTCATGCATTGGTTAGAAATATCAAGAATG]
GGGTTTGCAAAATAAGCTACAAGTAGCGATACTGCGATCTATACGCAAGGAATATAAGGATGTATAAACTAAGCTTAATTCATCTAAATAATATACATGG
| Populations | Population Size | Frequency of GATTCTTGATATTTCTAACC AATGCATGAAACAAAGTAGT ATAATCGAA(primary allele) | Frequency of CATTCTTGATATTTCTAACC AATGCATGAAACAAAGTAGT ATAATCGAA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.30% | 16.10% | 7.74% | 21.14% | G: 0.74% |
| All Indica | 2759 | 30.50% | 26.80% | 10.18% | 32.44% | G: 0.11% |
| All Japonica | 1512 | 92.50% | 0.70% | 3.57% | 1.12% | G: 2.12% |
| Aus | 269 | 62.10% | 1.50% | 7.81% | 28.62% | NA |
| Indica I | 595 | 5.00% | 11.80% | 9.08% | 74.12% | NA |
| Indica II | 465 | 27.30% | 31.20% | 23.44% | 18.06% | NA |
| Indica III | 913 | 49.40% | 31.20% | 3.83% | 15.22% | G: 0.33% |
| Indica Intermediate | 786 | 29.60% | 30.40% | 10.56% | 29.39% | NA |
| Temperate Japonica | 767 | 97.10% | 0.00% | 0.52% | 0.65% | G: 1.69% |
| Tropical Japonica | 504 | 82.90% | 2.20% | 9.33% | 1.98% | G: 3.57% |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 1.24% | 0.83% | G: 0.41% |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 7.80% | 10.00% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009351636 | GATTCTTGATATTTCTAACCAATGCATGAAACAAAGTAGTATAATCGAA -> CATTCTTGATATTTCTAACCAATGCATGAA ACAAAGTAGTATAATCGAA | LOC_Os10g18390.1 | downstream_gene_variant ; 3157.0bp to feature; MODIFIER | silent_mutation | Average:31.139; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg1009351636 | GATTCTTGATATTTCTAACCAATGCATGAAACAAAGTAGTATAATCGAA -> CATTCTTGATATTTCTAACCAATGCATGAA ACAAAGTAGTATAATCGAA | LOC_Os10g18400.1 | intron_variant ; MODIFIER | silent_mutation | Average:31.139; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg1009351636 | GATTCTTGATATTTCTAACCAATGCATGAAACAAAGTAGTATAATCGAA -> G | LOC_Os10g18390.1 | downstream_gene_variant ; 3158.0bp to feature; MODIFIER | silent_mutation | Average:31.139; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg1009351636 | GATTCTTGATATTTCTAACCAATGCATGAAACAAAGTAGTATAATCGAA -> G | LOC_Os10g18400.1 | intron_variant ; MODIFIER | silent_mutation | Average:31.139; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg1009351636 | GATTCTTGATATTTCTAACCAATGCATGAAACAAAGTAGTATAATCGAA -> DEL | N | N | silent_mutation | Average:31.139; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009351636 | NA | 1.92E-14 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009351636 | NA | 4.95E-12 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009351636 | 1.46E-06 | NA | mr1027_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009351636 | 1.71E-06 | 1.76E-09 | mr1027_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009351636 | NA | 4.46E-06 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009351636 | NA | 3.50E-12 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009351636 | NA | 2.91E-11 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009351636 | NA | 4.62E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |