\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009320431:

Variant ID: vg1009320431 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9320431
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


ACTCCGATGCCGACGACGAGGACGATGCCGAAGAACGCGACGGCGAGGGGGAAGCAGAGGAGGAGGAGGAGGCCGTGGCCGATAAGGCCGCGAACGAGGC[G/A]
GTCGGAGACCGCGTCGACACCCTCGGCTACACTCCTACCCCAAGTCCAGGTCCCAACGAGACCGGGGTGGAGTCGAACAGCTCCCCCCTTCGACGGAAGG

Reverse complement sequence

CCTTCCGTCGAAGGGGGGAGCTGTTCGACTCCACCCCGGTCTCGTTGGGACCTGGACTTGGGGTAGGAGTGTAGCCGAGGGTGTCGACGCGGTCTCCGAC[C/T]
GCCTCGTTCGCGGCCTTATCGGCCACGGCCTCCTCCTCCTCCTCTGCTTCCCCCTCGCCGTCGCGTTCTTCGGCATCGTCCTCGTCGTCGGCATCGGAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.60% 30.00% 0.38% 0.00% NA
All Indica  2759 60.00% 39.40% 0.58% 0.00% NA
All Japonica  1512 80.60% 19.40% 0.07% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 73.90% 25.40% 0.67% 0.00% NA
Indica II  465 40.40% 58.70% 0.86% 0.00% NA
Indica III  913 63.50% 36.10% 0.33% 0.00% NA
Indica Intermediate  786 56.90% 42.50% 0.64% 0.00% NA
Temperate Japonica  767 93.90% 6.10% 0.00% 0.00% NA
Tropical Japonica  504 55.80% 44.00% 0.20% 0.00% NA
Japonica Intermediate  241 90.00% 10.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009320431 G -> A LOC_Os10g18350.1 synonymous_variant ; p.Ala378Ala; LOW synonymous_codon Average:54.245; most accessible tissue: Zhenshan97 flag leaf, score: 79.006 N N N N
vg1009320431 G -> A LOC_Os10g18350.1 synonymous_variant ; p.Ala378Ala; LOW nonsynonymous_codon ; A378V Average:54.245; most accessible tissue: Zhenshan97 flag leaf, score: 79.006 possibly damaging 1.639 TOLERATED 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009320431 1.49E-06 1.78E-10 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320431 NA 7.76E-06 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320431 NA 3.57E-13 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320431 NA 3.78E-10 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320431 9.65E-06 NA mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320431 NA 2.14E-10 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320431 NA 3.52E-07 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320431 1.37E-08 5.32E-09 mr1053_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320431 4.01E-06 NA mr1070_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320431 1.36E-07 5.41E-07 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320431 3.29E-07 4.81E-07 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320431 4.50E-06 4.93E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320431 NA 1.33E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320431 6.83E-06 6.83E-06 mr1250_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320431 3.01E-06 2.61E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320431 NA 4.58E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320431 NA 1.03E-06 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320431 NA 1.99E-11 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320431 NA 5.57E-11 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251