Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009318290:

Variant ID: vg1009318290 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9318290
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

GTGAGATTGGAGCTTCGGCCGAGACCGTGCAAACCATGTGGTATGGTATGCGGCGCCCCCTTTCGACCGATTCTCCTGCCGAAACCTACACTATTCCTGC[G/A]
AATGAAGTTTGTTATTTGTGCGGCTGGTATTATTTTGCCGCTCTTCGCCTCCTGCGTTTGGTTGCATATTCATATATATATATATATATATATATATAGG

Reverse complement sequence

CCTATATATATATATATATATATATATATGAATATGCAACCAAACGCAGGAGGCGAAGAGCGGCAAAATAATACCAGCCGCACAAATAACAAACTTCATT[C/T]
GCAGGAATAGTGTAGGTTTCGGCAGGAGAATCGGTCGAAAGGGGGCGCCGCATACCATACCACATGGTTTGCACGGTCTCGGCCGAAGCTCCAATCTCAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.80%	24.20%	2.90%	6.12%	NA
All Indica	2759	58.40%	38.70%	1.12%	1.85%	NA
All Japonica	1512	80.80%	3.40%	6.08%	9.72%	NA
Aus	269	64.30%	1.90%	1.86%	31.97%	NA
Indica I	595	73.10%	24.90%	0.84%	1.18%	NA
Indica II	465	40.60%	58.10%	0.86%	0.43%	NA
Indica III	913	61.90%	34.70%	1.42%	1.97%	NA
Indica Intermediate	786	53.60%	42.20%	1.15%	3.05%	NA
Temperate Japonica	767	94.30%	0.30%	3.65%	1.83%	NA
Tropical Japonica	504	55.60%	9.30%	11.11%	24.01%	NA
Japonica Intermediate	241	90.50%	1.20%	3.32%	4.98%	NA
VI/Aromatic	96	95.80%	2.10%	1.04%	1.04%	NA
Intermediate	90	68.90%	17.80%	8.89%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009318290	G -> A	LOC_Os10g18350.1	upstream_gene_variant ; 876.0bp to feature; MODIFIER	silent_mutation	Average:24.669; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg1009318290	G -> A	LOC_Os10g18340.1	downstream_gene_variant ; 1943.0bp to feature; MODIFIER	silent_mutation	Average:24.669; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg1009318290	G -> A	LOC_Os10g18360.1	downstream_gene_variant ; 4902.0bp to feature; MODIFIER	silent_mutation	Average:24.669; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg1009318290	G -> A	LOC_Os10g18340.2	downstream_gene_variant ; 1947.0bp to feature; MODIFIER	silent_mutation	Average:24.669; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg1009318290	G -> A	LOC_Os10g18340-LOC_Os10g18350	intergenic_region ; MODIFIER	silent_mutation	Average:24.669; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg1009318290	G -> DEL	N	N	silent_mutation	Average:24.669; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009318290	4.12E-08	2.64E-12	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	9.09E-09	1.18E-08	mr1053	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	6.14E-06	NA	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	5.97E-06	NA	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	4.16E-07	4.52E-07	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	NA	8.60E-06	mr1145	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	2.68E-06	NA	mr1147	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	3.70E-07	4.06E-07	mr1147	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	NA	7.79E-06	mr1204	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	NA	4.13E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	NA	1.47E-11	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	NA	9.26E-10	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	NA	3.89E-07	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	1.78E-06	2.63E-09	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	9.48E-07	2.38E-07	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	2.35E-06	1.06E-12	mr1147_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	2.24E-06	1.90E-06	mr1147_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	NA	2.73E-06	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	NA	5.93E-06	mr1264_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	NA	6.23E-09	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290	NA	1.30E-08	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251