\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009318290:

Variant ID: vg1009318290 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9318290
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


GTGAGATTGGAGCTTCGGCCGAGACCGTGCAAACCATGTGGTATGGTATGCGGCGCCCCCTTTCGACCGATTCTCCTGCCGAAACCTACACTATTCCTGC[G/A]
AATGAAGTTTGTTATTTGTGCGGCTGGTATTATTTTGCCGCTCTTCGCCTCCTGCGTTTGGTTGCATATTCATATATATATATATATATATATATATAGG

Reverse complement sequence

CCTATATATATATATATATATATATATATGAATATGCAACCAAACGCAGGAGGCGAAGAGCGGCAAAATAATACCAGCCGCACAAATAACAAACTTCATT[C/T]
GCAGGAATAGTGTAGGTTTCGGCAGGAGAATCGGTCGAAAGGGGGCGCCGCATACCATACCACATGGTTTGCACGGTCTCGGCCGAAGCTCCAATCTCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.80% 24.20% 2.90% 6.12% NA
All Indica  2759 58.40% 38.70% 1.12% 1.85% NA
All Japonica  1512 80.80% 3.40% 6.08% 9.72% NA
Aus  269 64.30% 1.90% 1.86% 31.97% NA
Indica I  595 73.10% 24.90% 0.84% 1.18% NA
Indica II  465 40.60% 58.10% 0.86% 0.43% NA
Indica III  913 61.90% 34.70% 1.42% 1.97% NA
Indica Intermediate  786 53.60% 42.20% 1.15% 3.05% NA
Temperate Japonica  767 94.30% 0.30% 3.65% 1.83% NA
Tropical Japonica  504 55.60% 9.30% 11.11% 24.01% NA
Japonica Intermediate  241 90.50% 1.20% 3.32% 4.98% NA
VI/Aromatic  96 95.80% 2.10% 1.04% 1.04% NA
Intermediate  90 68.90% 17.80% 8.89% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009318290 G -> A LOC_Os10g18350.1 upstream_gene_variant ; 876.0bp to feature; MODIFIER silent_mutation Average:24.669; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1009318290 G -> A LOC_Os10g18340.1 downstream_gene_variant ; 1943.0bp to feature; MODIFIER silent_mutation Average:24.669; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1009318290 G -> A LOC_Os10g18360.1 downstream_gene_variant ; 4902.0bp to feature; MODIFIER silent_mutation Average:24.669; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1009318290 G -> A LOC_Os10g18340.2 downstream_gene_variant ; 1947.0bp to feature; MODIFIER silent_mutation Average:24.669; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1009318290 G -> A LOC_Os10g18340-LOC_Os10g18350 intergenic_region ; MODIFIER silent_mutation Average:24.669; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1009318290 G -> DEL N N silent_mutation Average:24.669; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009318290 4.12E-08 2.64E-12 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 9.09E-09 1.18E-08 mr1053 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 6.14E-06 NA mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 5.97E-06 NA mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 4.16E-07 4.52E-07 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 NA 8.60E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 2.68E-06 NA mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 3.70E-07 4.06E-07 mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 NA 7.79E-06 mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 NA 4.13E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 NA 1.47E-11 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 NA 9.26E-10 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 NA 3.89E-07 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 1.78E-06 2.63E-09 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 9.48E-07 2.38E-07 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 2.35E-06 1.06E-12 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 2.24E-06 1.90E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 NA 2.73E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 NA 5.93E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 NA 6.23E-09 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318290 NA 1.30E-08 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251