\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009276703:

Variant ID: vg1009276703 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9276703
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGTTTATACTGGTTCAGGCCCTCAGCGCGGGGTAATACCTTAGTCCAGTCAGTGTAGATTAGATCTGTATTGGTGTGCGCAGATCAGCGTAGGAATAG[C/T]
CGATAGCGTGTATACGGGAGAATGATCAATCCTTAGCGTTTCCCCCGCGCCCCTTATATAATCACGGTGTCGGCCAGCTAGTGATGGTAAGGTAGCCCTT

Reverse complement sequence

AAGGGCTACCTTACCATCACTAGCTGGCCGACACCGTGATTATATAAGGGGCGCGGGGGAAACGCTAAGGATTGATCATTCTCCCGTATACACGCTATCG[G/A]
CTATTCCTACGCTGATCTGCGCACACCAATACAGATCTAATCTACACTGACTGGACTAAGGTATTACCCCGCGCTGAGGGCCTGAACCAGTATAAACAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.40% 11.60% 0.00% 0.00% NA
All Indica  2759 96.60% 3.40% 0.00% 0.00% NA
All Japonica  1512 91.40% 8.60% 0.00% 0.00% NA
Aus  269 2.20% 97.80% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 97.50% 2.50% 0.00% 0.00% NA
Indica Intermediate  786 92.60% 7.40% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 78.60% 21.40% 0.00% 0.00% NA
Japonica Intermediate  241 91.70% 8.30% 0.00% 0.00% NA
VI/Aromatic  96 56.20% 43.80% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009276703 C -> T LOC_Os10g18250.1 downstream_gene_variant ; 445.0bp to feature; MODIFIER silent_mutation Average:79.274; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N
vg1009276703 C -> T LOC_Os10g18260.1 downstream_gene_variant ; 1450.0bp to feature; MODIFIER silent_mutation Average:79.274; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N
vg1009276703 C -> T LOC_Os10g18250-LOC_Os10g18260 intergenic_region ; MODIFIER silent_mutation Average:79.274; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1009276703 C T -0.02 -0.02 -0.02 -0.03 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009276703 NA 3.64E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703 NA 7.10E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703 NA 4.61E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703 NA 1.10E-07 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703 NA 7.46E-08 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703 NA 2.34E-19 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703 NA 1.06E-11 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703 NA 7.02E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703 NA 3.08E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703 NA 9.41E-10 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703 8.19E-06 NA mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703 4.16E-06 NA mr1769_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703 NA 1.48E-06 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703 NA 6.63E-12 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703 NA 9.32E-09 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251