Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1009276703:

Variant ID: vg1009276703 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9276703
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

GTTGTTTATACTGGTTCAGGCCCTCAGCGCGGGGTAATACCTTAGTCCAGTCAGTGTAGATTAGATCTGTATTGGTGTGCGCAGATCAGCGTAGGAATAG[C/T]
CGATAGCGTGTATACGGGAGAATGATCAATCCTTAGCGTTTCCCCCGCGCCCCTTATATAATCACGGTGTCGGCCAGCTAGTGATGGTAAGGTAGCCCTT

Reverse complement sequence

AAGGGCTACCTTACCATCACTAGCTGGCCGACACCGTGATTATATAAGGGGCGCGGGGGAAACGCTAAGGATTGATCATTCTCCCGTATACACGCTATCG[G/A]
CTATTCCTACGCTGATCTGCGCACACCAATACAGATCTAATCTACACTGACTGGACTAAGGTATTACCCCGCGCTGAGGGCCTGAACCAGTATAAACAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.40%	11.60%	0.00%	0.00%	NA
All Indica	2759	96.60%	3.40%	0.00%	0.00%	NA
All Japonica	1512	91.40%	8.60%	0.00%	0.00%	NA
Aus	269	2.20%	97.80%	0.00%	0.00%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	97.50%	2.50%	0.00%	0.00%	NA
Indica Intermediate	786	92.60%	7.40%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	78.60%	21.40%	0.00%	0.00%	NA
Japonica Intermediate	241	91.70%	8.30%	0.00%	0.00%	NA
VI/Aromatic	96	56.20%	43.80%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009276703	C -> T	LOC_Os10g18250.1	downstream_gene_variant ; 445.0bp to feature; MODIFIER	silent_mutation	Average:79.274; most accessible tissue: Zhenshan97 young leaf, score: 89.772	N	N	N	N
vg1009276703	C -> T	LOC_Os10g18260.1	downstream_gene_variant ; 1450.0bp to feature; MODIFIER	silent_mutation	Average:79.274; most accessible tissue: Zhenshan97 young leaf, score: 89.772	N	N	N	N
vg1009276703	C -> T	LOC_Os10g18250-LOC_Os10g18260	intergenic_region ; MODIFIER	silent_mutation	Average:79.274; most accessible tissue: Zhenshan97 young leaf, score: 89.772	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1009276703	C	T	-0.02	-0.02	-0.02	-0.03	-0.03	-0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009276703	NA	3.64E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703	NA	7.10E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703	NA	4.61E-08	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703	NA	1.10E-07	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703	NA	7.46E-08	mr1808	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703	NA	2.34E-19	mr1961	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703	NA	1.06E-11	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703	NA	7.02E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703	NA	3.08E-06	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703	NA	9.41E-10	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703	8.19E-06	NA	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703	4.16E-06	NA	mr1769_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703	NA	1.48E-06	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703	NA	6.63E-12	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009276703	NA	9.32E-09	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251