\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009262901:

Variant ID: vg1009262901 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9262901
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCGATGCCGATCCCGATGCCGCCGCCTCCGTCCAAACTGCCTTGACTGTGTGCCAGGCGTCGGCACAAGCCACCGGTGGTGCTTGCCGCCGTCGATCC[G/A]
CAACCCCACTCTTCCCCGCCACAGGTTAGTCCTAAACTCCCTTGCTCCCCATCCTCCATGTCCCTCTTCTCTCTTTTCCCTTGGAGGTAGGTGCAAGGAG

Reverse complement sequence

CTCCTTGCACCTACCTCCAAGGGAAAAGAGAGAAGAGGGACATGGAGGATGGGGAGCAAGGGAGTTTAGGACTAACCTGTGGCGGGGAAGAGTGGGGTTG[C/T]
GGATCGACGGCGGCAAGCACCACCGGTGGCTTGTGCCGACGCCTGGCACACAGTCAAGGCAGTTTGGACGGAGGCGGCGGCATCGGGATCGGCATCGGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.60% 1.50% 0.95% 0.00% NA
All Indica  2759 95.90% 2.40% 1.63% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 90.10% 5.50% 4.37% 0.00% NA
Indica II  465 98.70% 0.60% 0.65% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 95.00% 2.90% 2.04% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009262901 G -> A LOC_Os10g18234.1 synonymous_variant ; p.Cys136Cys; LOW synonymous_codon Average:58.608; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009262901 NA 5.13E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262901 NA 1.46E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262901 3.19E-06 1.95E-07 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262901 NA 1.69E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262901 4.06E-06 2.86E-10 mr1053_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262901 8.38E-06 4.49E-09 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262901 2.95E-06 NA mr1128_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262901 7.67E-07 9.35E-11 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262901 NA 3.65E-07 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262901 NA 7.64E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262901 NA 8.58E-08 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262901 NA 7.17E-09 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262901 NA 4.40E-08 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262901 NA 7.34E-09 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262901 NA 6.30E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262901 NA 2.39E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262901 6.67E-07 2.11E-08 mr1250_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262901 2.44E-07 2.44E-07 mr1250_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262901 NA 5.61E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262901 NA 8.18E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251