\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009167787:

Variant ID: vg1009167787 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9167787
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CTTATGATTGTCCCACCCCAGATCCATGTTGCCAAGCTTGTCATTGTCCCCCGAGCTCAAGTGTTGGTGACCTCGTCCTTGTCTCTTGCTTCGCGTTGCT[G/A]
AGATCGTCAACAAGATGAATGGCAACGACAGCCAATGCAAGGTTGAACCGCTGCGCCTTCCACATGGCCCATAAGGCTAGGTGCCACACCTCGGCCAGAG

Reverse complement sequence

CTCTGGCCGAGGTGTGGCACCTAGCCTTATGGGCCATGTGGAAGGCGCAGCGGTTCAACCTTGCATTGGCTGTCGTTGCCATTCATCTTGTTGACGATCT[C/T]
AGCAACGCGAAGCAAGAGACAAGGACGAGGTCACCAACACTTGAGCTCGGGGGACAATGACAAGCTTGGCAACATGGATCTGGGGTGGGACAATCATAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.40% 30.40% 0.06% 0.17% NA
All Indica  2759 59.40% 40.20% 0.11% 0.29% NA
All Japonica  1512 80.60% 19.40% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 73.80% 25.90% 0.17% 0.17% NA
Indica II  465 40.00% 59.60% 0.00% 0.43% NA
Indica III  913 62.80% 37.00% 0.11% 0.11% NA
Indica Intermediate  786 56.00% 43.40% 0.13% 0.51% NA
Temperate Japonica  767 93.90% 6.10% 0.00% 0.00% NA
Tropical Japonica  504 55.80% 44.20% 0.00% 0.00% NA
Japonica Intermediate  241 90.00% 10.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009167787 G -> A LOC_Os10g18080.1 synonymous_variant ; p.Leu22Leu; LOW synonymous_codon Average:74.063; most accessible tissue: Zhenshan97 young leaf, score: 90.078 N N N N
vg1009167787 G -> DEL LOC_Os10g18080.1 N frameshift_variant Average:74.063; most accessible tissue: Zhenshan97 young leaf, score: 90.078 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009167787 1.86E-08 1.51E-12 mr1053 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009167787 3.67E-07 4.77E-07 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009167787 4.25E-06 NA mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009167787 1.32E-06 2.59E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009167787 8.37E-06 NA mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009167787 NA 1.36E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009167787 NA 5.91E-12 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009167787 NA 5.62E-09 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009167787 NA 1.13E-09 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009167787 NA 1.94E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009167787 6.89E-07 1.80E-07 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009167787 2.50E-06 2.92E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009167787 NA 1.40E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009167787 NA 4.58E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009167787 NA 9.50E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009167787 NA 7.89E-10 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009167787 NA 2.27E-09 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251