Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1007891011:

Variant ID: vg1007891011 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 7891011
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, T: 0.16, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

CGGAGCCGATTTCTAGATAACTACGCGTCTCCTGGGCAAAACGGAAGGTTTTCAGGACAAACCTACAAAGAGATGTCACACTCTCGCAGCGGCGGCGGAC[G/T,A]
GTTTACGGCGCAAACCAACAAAGATGGACAAACTAAGAGAAAACTAAAAGCAATATGAAAAAGAACGATTCGATTGATGGATTGTAGATTGGTTTTTTAC

Reverse complement sequence

GTAAAAAACCAATCTACAATCCATCAATCGAATCGTTCTTTTTCATATTGCTTTTAGTTTTCTCTTAGTTTGTCCATCTTTGTTGGTTTGCGCCGTAAAC[C/A,T]
GTCCGCCGCCGCTGCGAGAGTGTGACATCTCTTTGTAGGTTTGTCCTGAAAACCTTCCGTTTTGCCCAGGAGACGCGTAGTTATCTAGAAATCGGCTCCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.00%	3.30%	12.40%	57.74%	A: 2.52%
All Indica	2759	6.90%	0.70%	15.62%	72.53%	A: 4.20%
All Japonica	1512	59.30%	5.70%	3.04%	31.81%	A: 0.13%
Aus	269	3.70%	0.40%	34.94%	60.97%	NA
Indica I	595	10.90%	0.00%	11.60%	76.81%	A: 0.67%
Indica II	465	4.70%	0.00%	18.71%	68.60%	A: 7.96%
Indica III	913	4.70%	1.90%	16.32%	72.95%	A: 4.16%
Indica Intermediate	786	7.80%	0.40%	16.03%	71.12%	A: 4.71%
Temperate Japonica	767	88.30%	0.30%	0.78%	10.43%	A: 0.26%
Tropical Japonica	504	13.10%	15.70%	6.94%	64.29%	NA
Japonica Intermediate	241	63.90%	2.10%	2.07%	31.95%	NA
VI/Aromatic	96	9.40%	40.60%	9.38%	40.62%	NA
Intermediate	90	31.10%	12.20%	6.67%	48.89%	A: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1007891011	G -> T	LOC_Os10g15060.1	upstream_gene_variant ; 3252.0bp to feature; MODIFIER	silent_mutation	Average:9.614; most accessible tissue: Callus, score: 28.559	N	N	N	N
vg1007891011	G -> T	LOC_Os10g15079.1	downstream_gene_variant ; 490.0bp to feature; MODIFIER	silent_mutation	Average:9.614; most accessible tissue: Callus, score: 28.559	N	N	N	N
vg1007891011	G -> T	LOC_Os10g15060-LOC_Os10g15079	intergenic_region ; MODIFIER	silent_mutation	Average:9.614; most accessible tissue: Callus, score: 28.559	N	N	N	N
vg1007891011	G -> A	LOC_Os10g15060.1	upstream_gene_variant ; 3252.0bp to feature; MODIFIER	silent_mutation	Average:9.614; most accessible tissue: Callus, score: 28.559	N	N	N	N
vg1007891011	G -> A	LOC_Os10g15079.1	downstream_gene_variant ; 490.0bp to feature; MODIFIER	silent_mutation	Average:9.614; most accessible tissue: Callus, score: 28.559	N	N	N	N
vg1007891011	G -> A	LOC_Os10g15060-LOC_Os10g15079	intergenic_region ; MODIFIER	silent_mutation	Average:9.614; most accessible tissue: Callus, score: 28.559	N	N	N	N
vg1007891011	G -> DEL	N	N	silent_mutation	Average:9.614; most accessible tissue: Callus, score: 28.559	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1007891011	NA	5.04E-07	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007891011	NA	1.97E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007891011	1.35E-08	1.67E-10	mr1188_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007891011	NA	1.66E-07	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007891011	NA	1.90E-06	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251