\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007820831:

Variant ID: vg1007820831 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 7820831
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAGAAAAAAAATATTTTGATGCATTATATTAATGGTAGAGACCATATTGTATCCAACTGTTGTATAACGTTAGGCTCTAGAAACGTATAGCTCATACCT[G/A]
TCTCTACCTTTGTACATGTCCTTACTAGCGAACCGTTGGCAGAGACGATAATATTGGCCTGCATGTATAAATATAAGCAATTTTAAAATTAAGTATGGGA

Reverse complement sequence

TCCCATACTTAATTTTAAAATTGCTTATATTTATACATGCAGGCCAATATTATCGTCTCTGCCAACGGTTCGCTAGTAAGGACATGTACAAAGGTAGAGA[C/T]
AGGTATGAGCTATACGTTTCTAGAGCCTAACGTTATACAACAGTTGGATACAATATGGTCTCTACCATTAATATAATGCATCAAAATATTTTTTTTCTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.60% 19.30% 0.04% 0.00% NA
All Indica  2759 99.20% 0.80% 0.04% 0.00% NA
All Japonica  1512 42.70% 57.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.10% 0.13% 0.00% NA
Temperate Japonica  767 12.00% 88.00% 0.00% 0.00% NA
Tropical Japonica  504 90.10% 9.90% 0.00% 0.00% NA
Japonica Intermediate  241 41.50% 58.50% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1007820831 G -> A LOC_Os10g14920.1 upstream_gene_variant ; 3693.0bp to feature; MODIFIER silent_mutation Average:61.792; most accessible tissue: Zhenshan97 root, score: 82.549 N N N N
vg1007820831 G -> A LOC_Os10g14920.2 upstream_gene_variant ; 3693.0bp to feature; MODIFIER silent_mutation Average:61.792; most accessible tissue: Zhenshan97 root, score: 82.549 N N N N
vg1007820831 G -> A LOC_Os10g14920.5 upstream_gene_variant ; 3699.0bp to feature; MODIFIER silent_mutation Average:61.792; most accessible tissue: Zhenshan97 root, score: 82.549 N N N N
vg1007820831 G -> A LOC_Os10g14920.3 upstream_gene_variant ; 3699.0bp to feature; MODIFIER silent_mutation Average:61.792; most accessible tissue: Zhenshan97 root, score: 82.549 N N N N
vg1007820831 G -> A LOC_Os10g14920.7 upstream_gene_variant ; 3696.0bp to feature; MODIFIER silent_mutation Average:61.792; most accessible tissue: Zhenshan97 root, score: 82.549 N N N N
vg1007820831 G -> A LOC_Os10g14920.6 upstream_gene_variant ; 3693.0bp to feature; MODIFIER silent_mutation Average:61.792; most accessible tissue: Zhenshan97 root, score: 82.549 N N N N
vg1007820831 G -> A LOC_Os10g14920-LOC_Os10g14930 intergenic_region ; MODIFIER silent_mutation Average:61.792; most accessible tissue: Zhenshan97 root, score: 82.549 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1007820831 NA 1.50E-24 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 7.95E-08 8.15E-43 mr1310 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 1.22E-08 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 1.35E-37 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 3.43E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 9.02E-23 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 8.96E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 1.66E-09 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 5.01E-10 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 5.97E-20 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 9.76E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 1.06E-06 1.26E-45 mr1926 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 1.03E-08 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 6.69E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 1.18E-36 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 2.93E-11 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 5.40E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 2.14E-12 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 4.30E-33 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 2.11E-28 mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 1.61E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 2.39E-39 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 6.52E-21 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 4.64E-18 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 4.94E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 3.48E-28 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 2.36E-13 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 4.05E-14 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007820831 NA 2.52E-07 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251