\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007190202:

Variant ID: vg1007190202 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 7190202
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TATAAAATGGCTTTGGGCAACTAAGTGACTTGTAAATGCTGTTTGCTGCAAAACTTAACCTCTATATTATTATCCCCTTGTACTCCCTTGCATTAATTAT[A/G]
CATCTCCGGTGTGGCTTGCTGAGTACTGTGGTTGTACTCATTCTTGCTCTATCTTTCTCCCCCCTTCAGTAAGAGAAGCTTTGGAGAAGAAGTCTTAGGT

Reverse complement sequence

ACCTAAGACTTCTTCTCCAAAGCTTCTCTTACTGAAGGGGGGAGAAAGATAGAGCAAGAATGAGTACAACCACAGTACTCAGCAAGCCACACCGGAGATG[T/C]
ATAATTAATGCAAGGGAGTACAAGGGGATAATAATATAGAGGTTAAGTTTTGCAGCAAACAGCATTTACAAGTCACTTAGTTGCCCAAAGCCATTTTATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 17.40% 6.80% 23.44% 52.37% NA
All Indica  2759 4.70% 1.60% 31.64% 62.12% NA
All Japonica  1512 41.50% 17.30% 9.66% 31.48% NA
Aus  269 3.00% 1.10% 6.32% 89.59% NA
Indica I  595 6.90% 0.70% 15.63% 76.81% NA
Indica II  465 2.80% 0.40% 20.86% 75.91% NA
Indica III  913 3.80% 3.60% 51.26% 41.29% NA
Indica Intermediate  786 5.10% 0.50% 27.35% 67.05% NA
Temperate Japonica  767 58.50% 6.00% 2.22% 33.25% NA
Tropical Japonica  504 10.10% 39.10% 21.43% 29.37% NA
Japonica Intermediate  241 53.10% 7.90% 8.71% 30.29% NA
VI/Aromatic  96 29.20% 3.10% 56.25% 11.46% NA
Intermediate  90 30.00% 13.30% 20.00% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1007190202 A -> G LOC_Os10g13320.1 downstream_gene_variant ; 329.0bp to feature; MODIFIER silent_mutation Average:9.639; most accessible tissue: Callus, score: 20.998 N N N N
vg1007190202 A -> G LOC_Os10g13310-LOC_Os10g13320 intergenic_region ; MODIFIER silent_mutation Average:9.639; most accessible tissue: Callus, score: 20.998 N N N N
vg1007190202 A -> DEL N N silent_mutation Average:9.639; most accessible tissue: Callus, score: 20.998 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1007190202 NA 3.17E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007190202 2.24E-07 NA mr1118 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007190202 NA 2.50E-08 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007190202 NA 1.68E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007190202 NA 1.93E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007190202 NA 2.75E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007190202 NA 6.95E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007190202 NA 2.41E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007190202 NA 4.43E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007190202 NA 1.02E-06 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007190202 NA 9.45E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007190202 NA 1.74E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007190202 NA 3.40E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007190202 NA 9.42E-06 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007190202 NA 4.35E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251