\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006851906:

Variant ID: vg1006851906 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 6851906
Reference Allele: AAlternative Allele: G,AG,AGG,AGGG
Primary Allele: GSecondary Allele: AG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGGATGGATCAGCATAGTAGAGAAGTGTCACTTTTATCCTGCCATCACTCCTTGGTGGACTATTGAAAGTCACCTATGCCAAGGAGGAAGAAATTGGGG[A/G,AG,AGG,AGGG]
GGGGGGTGATGTACAGCTGACCTGGAGACGGGAAGGCCGGGCAGCAAATCATCAGGTAACGATGGCGGCTGCGATGAACCTGTGCCAGTGACCTACAACA

Reverse complement sequence

TGTTGTAGGTCACTGGCACAGGTTCATCGCAGCCGCCATCGTTACCTGATGATTTGCTGCCCGGCCTTCCCGTCTCCAGGTCAGCTGTACATCACCCCCC[T/C,CT,CCT,CCCT]
CCCCAATTTCTTCCTCCTTGGCATAGGTGACTTTCAATAGTCCACCAAGGAGTGATGGCAGGATAAAAGTGACACTTCTCTACTATGCTGATCCATCCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of AG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.40% 30.70% 2.39% 0.02% AGG: 19.21%; A: 14.22%; AGGG: 0.06%
All Indica  2759 36.70% 35.70% 0.62% 0.00% AGG: 24.86%; A: 1.96%; AGGG: 0.11%
All Japonica  1512 18.70% 22.60% 6.02% 0.07% A: 38.82%; AGG: 13.82%
Aus  269 95.20% 1.50% 0.00% 0.00% A: 2.23%; AGG: 1.12%
Indica I  595 87.10% 9.70% 0.17% 0.00% AGG: 1.85%; A: 1.18%
Indica II  465 17.00% 58.70% 0.65% 0.00% AGG: 23.01%; A: 0.65%
Indica III  913 16.20% 37.10% 0.44% 0.00% AGG: 44.03%; A: 2.08%; AGGG: 0.11%
Indica Intermediate  786 34.10% 40.20% 1.15% 0.00% AGG: 21.12%; A: 3.18%; AGGG: 0.25%
Temperate Japonica  767 10.30% 22.60% 7.56% 0.00% A: 54.89%; AGG: 4.69%
Tropical Japonica  504 35.50% 28.40% 4.76% 0.20% AGG: 22.22%; A: 8.93%
Japonica Intermediate  241 10.00% 10.80% 3.73% 0.00% A: 50.21%; AGG: 25.31%
VI/Aromatic  96 1.00% 88.50% 0.00% 0.00% A: 10.42%
Intermediate  90 30.00% 36.70% 5.56% 0.00% A: 16.67%; AGG: 11.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006851906 A -> G LOC_Os10g12300-LOC_Os10g12320 intergenic_region ; MODIFIER silent_mutation Average:45.203; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N
vg1006851906 A -> AGGG LOC_Os10g12300-LOC_Os10g12320 intergenic_region ; MODIFIER silent_mutation Average:45.203; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N
vg1006851906 A -> AG LOC_Os10g12300-LOC_Os10g12320 intergenic_region ; MODIFIER silent_mutation Average:45.203; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N
vg1006851906 A -> DEL N N silent_mutation Average:45.203; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N
vg1006851906 A -> AGG LOC_Os10g12300-LOC_Os10g12320 intergenic_region ; MODIFIER silent_mutation Average:45.203; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006851906 5.42E-07 7.19E-19 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 5.31E-06 NA mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 7.24E-09 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 9.12E-09 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 9.43E-08 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 4.40E-09 1.23E-23 mr1118 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 1.25E-10 1.08E-22 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 8.73E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 3.46E-07 4.70E-18 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 6.00E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 7.58E-06 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 8.22E-10 5.24E-33 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 1.77E-10 1.04E-28 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 6.13E-11 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 3.57E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 5.15E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 4.15E-06 mr1789 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 9.35E-07 6.02E-12 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 1.56E-06 4.00E-14 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 8.33E-06 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 1.35E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 4.25E-06 4.24E-06 mr1950 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 3.14E-07 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 2.12E-07 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 2.16E-23 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 5.23E-07 2.07E-26 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 2.78E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 8.95E-08 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 2.57E-06 3.19E-19 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 4.91E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 4.26E-32 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 5.18E-07 1.07E-29 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 1.29E-09 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 2.14E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 2.01E-16 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 5.52E-06 5.25E-19 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 4.41E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 2.82E-11 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006851906 NA 1.28E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251