Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006755863:

Variant ID: vg1006755863 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 6755863
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTTCACCGTCAACCGCCTTCGTCGTCGTCGGCTGGTGTCTTCATTGTTATTGATGGACGATTTTGTTCCCATATTGGCCACCTCTGCCATCACCAAGGG[G/A]
AATATTACAAAGCTAAGTCATCATGAATTTTCTTTATATGATATTTTTCTTTTCTTCTGCCTCACTACATCAACTGGTTCGCCGTTGACTAGTGAGTCGG

Reverse complement sequence

CCGACTCACTAGTCAACGGCGAACCAGTTGATGTAGTGAGGCAGAAGAAAAGAAAAATATCATATAAAGAAAATTCATGATGACTTAGCTTTGTAATATT[C/T]
CCCTTGGTGATGGCAGAGGTGGCCAATATGGGAACAAAATCGTCCATCAATAACAATGAAGACACCAGCCGACGACGACGAAGGCGGTTGACGGTGAAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.60%	4.80%	0.78%	48.84%	NA
All Indica	2759	47.30%	0.30%	0.98%	51.43%	NA
All Japonica	1512	50.50%	10.50%	0.40%	38.62%	NA
Aus	269	0.40%	0.40%	0.74%	98.51%	NA
Indica I	595	92.80%	0.00%	0.84%	6.39%	NA
Indica II	465	39.80%	0.00%	0.65%	59.57%	NA
Indica III	913	20.00%	0.20%	0.77%	78.97%	NA
Indica Intermediate	786	49.00%	0.80%	1.53%	48.73%	NA
Temperate Japonica	767	75.20%	0.30%	0.52%	23.99%	NA
Tropical Japonica	504	9.70%	28.40%	0.40%	61.51%	NA
Japonica Intermediate	241	56.80%	5.80%	0.00%	37.34%	NA
VI/Aromatic	96	43.80%	50.00%	0.00%	6.25%	NA
Intermediate	90	47.80%	12.20%	2.22%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1006755863	G -> A	LOC_Os10g12140.1	downstream_gene_variant ; 1806.0bp to feature; MODIFIER	silent_mutation	Average:24.092; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg1006755863	G -> A	LOC_Os10g12149.1	downstream_gene_variant ; 3984.0bp to feature; MODIFIER	silent_mutation	Average:24.092; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg1006755863	G -> A	LOC_Os10g12140-LOC_Os10g12149	intergenic_region ; MODIFIER	silent_mutation	Average:24.092; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg1006755863	G -> DEL	N	N	silent_mutation	Average:24.092; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1006755863	NA	7.58E-06	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006755863	NA	3.64E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006755863	9.31E-06	9.31E-06	mr1173	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006755863	NA	1.13E-06	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006755863	8.08E-06	NA	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006755863	NA	2.11E-09	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006755863	NA	4.21E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006755863	NA	1.16E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006755863	NA	5.24E-09	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006755863	NA	1.76E-08	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006755863	NA	1.34E-06	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006755863	NA	6.65E-06	mr1195_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006755863	5.95E-07	5.95E-07	mr1333_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006755863	NA	2.06E-06	mr1438_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006755863	NA	9.02E-06	mr1686_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006755863	NA	5.87E-06	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251