\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006742777:

Variant ID: vg1006742777 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6742777
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATCCCTAGTTGAGACGATGACATGTTCCGTAGTACGGTTGCAGTGCTTGATTAGTAAATATGAAAACGAAAATAATAAAGGTGGTTTCCATCCGTTTT[C/T]
GTACAGTTTTCATCCCTAGTTGCGACGATGACATGTTCCGTAGTACGGTTGCAGTGCTTGATTGGTAAATTTATACTGCCTGTGCGTTGCAACAGAAAAA

Reverse complement sequence

TTTTTCTGTTGCAACGCACAGGCAGTATAAATTTACCAATCAAGCACTGCAACCGTACTACGGAACATGTCATCGTCGCAACTAGGGATGAAAACTGTAC[G/A]
AAAACGGATGGAAACCACCTTTATTATTTTCGTTTTCATATTTACTAATCAAGCACTGCAACCGTACTACGGAACATGTCATCGTCTCAACTAGGGATGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.80% 1.10% 1.67% 51.48% NA
All Indica  2759 35.50% 1.80% 2.07% 60.64% NA
All Japonica  1512 68.10% 0.00% 0.20% 31.75% NA
Aus  269 4.80% 0.00% 5.95% 89.22% NA
Indica I  595 77.10% 5.70% 5.55% 11.60% NA
Indica II  465 18.50% 0.60% 0.65% 80.22% NA
Indica III  913 18.10% 0.00% 0.88% 81.05% NA
Indica Intermediate  786 34.40% 1.50% 1.65% 62.47% NA
Temperate Japonica  767 89.70% 0.00% 0.26% 10.04% NA
Tropical Japonica  504 37.90% 0.00% 0.20% 61.90% NA
Japonica Intermediate  241 62.20% 0.00% 0.00% 37.76% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 54.40% 1.10% 3.33% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006742777 C -> T LOC_Os10g12130.1 upstream_gene_variant ; 2679.0bp to feature; MODIFIER silent_mutation Average:20.177; most accessible tissue: Callus, score: 53.444 N N N N
vg1006742777 C -> T LOC_Os10g12130-LOC_Os10g12140 intergenic_region ; MODIFIER silent_mutation Average:20.177; most accessible tissue: Callus, score: 53.444 N N N N
vg1006742777 C -> DEL N N silent_mutation Average:20.177; most accessible tissue: Callus, score: 53.444 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006742777 7.24E-07 2.52E-08 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006742777 2.37E-06 3.25E-09 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006742777 5.95E-09 4.52E-11 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006742777 2.66E-06 1.38E-06 mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006742777 NA 2.42E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006742777 3.95E-06 NA mr1204 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006742777 3.15E-06 NA mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006742777 6.58E-06 1.21E-08 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006742777 1.38E-07 2.81E-11 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006742777 NA 6.79E-07 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006742777 NA 5.76E-08 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006742777 NA 2.43E-07 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251