\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006726777:

Variant ID: vg1006726777 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6726777
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTAAAATCAACAACATAGGAAGAAAAATATATGATGATCGATATATTGAGAATGAAGGGAAGAATAATGTGTTTTTACCTTGAATTTTAGCAAAAATT[C/T]
GCCCCCCTTGCACTCCCAACCGATTTGTGAACAGTGAAATGGTCGGGATGGAAAGCAGTTGGCGGTTTGGGGGGTATTTATAGACCCAACACACCTCAAA

Reverse complement sequence

TTTGAGGTGTGTTGGGTCTATAAATACCCCCCAAACCGCCAACTGCTTTCCATCCCGACCATTTCACTGTTCACAAATCGGTTGGGAGTGCAAGGGGGGC[G/A]
AATTTTTGCTAAAATTCAAGGTAAAAACACATTATTCTTCCCTTCATTCTCAATATATCGATCATCATATATTTTTCTTCCTATGTTGTTGATTTTAGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.10% 43.40% 1.57% 0.93% NA
All Indica  2759 40.70% 55.50% 2.43% 1.41% NA
All Japonica  1512 67.80% 31.60% 0.26% 0.33% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 89.40% 9.20% 1.01% 0.34% NA
Indica II  465 20.60% 73.30% 3.66% 2.37% NA
Indica III  913 20.00% 76.00% 2.63% 1.31% NA
Indica Intermediate  786 39.70% 56.00% 2.54% 1.78% NA
Temperate Japonica  767 89.20% 10.00% 0.26% 0.52% NA
Tropical Japonica  504 38.30% 61.10% 0.40% 0.20% NA
Japonica Intermediate  241 61.40% 38.60% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 58.90% 38.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006726777 C -> T LOC_Os10g12120.1 upstream_gene_variant ; 3130.0bp to feature; MODIFIER silent_mutation Average:28.404; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg1006726777 C -> T LOC_Os10g12110.1 intron_variant ; MODIFIER silent_mutation Average:28.404; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg1006726777 C -> DEL N N silent_mutation Average:28.404; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006726777 NA 8.87E-14 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 1.72E-08 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 3.08E-08 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 3.67E-07 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 4.72E-08 6.03E-18 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 2.61E-13 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 6.12E-06 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 2.78E-06 4.15E-23 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 3.29E-08 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 1.12E-06 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 5.03E-13 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 1.18E-12 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 3.74E-06 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 7.27E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 1.83E-06 1.35E-08 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 3.26E-06 1.12E-08 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 6.53E-06 1.82E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 2.30E-20 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 2.57E-06 2.02E-06 mr1119_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 3.47E-07 5.36E-10 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 4.00E-14 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 1.01E-06 1.11E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 2.59E-23 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 5.61E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 3.05E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 2.50E-20 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 7.26E-18 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 6.35E-08 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006726777 NA 3.25E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251