\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006723044:

Variant ID: vg1006723044 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 6723044
Reference Allele: CAlternative Allele: CT,T
Primary Allele: CSecondary Allele: CT

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CCCGCACCTGAGGGCTGAGGATGAGCACCTCCTCCATCCTCGTGCGGGTGCGGAACCAACTGTGGCGTCGTGCCGATCACCAGTACAAAATCCATTTTCT[C/CT,T]
GTGTTGTCCAAATCTATTTTTCCGCGCGGAGGTAACACCCGTTTGCACTCAAGGGTATGTAAAAATTAATATTTTCACGTATGGGCAGCCCAACCGCACG

Reverse complement sequence

CGTGCGGTTGGGCTGCCCATACGTGAAAATATTAATTTTTACATACCCTTGAGTGCAAACGGGTGTTACCTCCGCGCGGAAAAATAGATTTGGACAACAC[G/AG,A]
AGAAAATGGATTTTGTACTGGTGATCGGCACGACGCCACAGTTGGTTCCGCACCCGCACGAGGATGGAGGAGGTGCTCATCCTCAGCCCTCAGGTGCGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of CT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.90% 29.80% 4.51% 6.20% T: 4.61%
All Indica  2759 39.90% 44.20% 6.49% 9.17% T: 0.25%
All Japonica  1512 74.90% 10.80% 1.98% 2.18% T: 10.19%
Aus  269 97.80% 0.70% 0.00% 1.12% T: 0.37%
Indica I  595 89.20% 6.90% 3.03% 0.84% NA
Indica II  465 18.90% 59.40% 12.47% 9.25% NA
Indica III  913 20.00% 58.30% 5.37% 16.10% T: 0.22%
Indica Intermediate  786 37.90% 47.20% 6.87% 7.38% T: 0.64%
Temperate Japonica  767 94.90% 3.50% 0.52% 0.78% T: 0.26%
Tropical Japonica  504 49.40% 16.50% 2.98% 3.57% T: 27.58%
Japonica Intermediate  241 64.30% 22.00% 4.56% 3.73% T: 5.39%
VI/Aromatic  96 47.90% 2.10% 1.04% 1.04% T: 47.92%
Intermediate  90 61.10% 21.10% 3.33% 3.33% T: 11.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006723044 C -> CT LOC_Os10g12090.1 upstream_gene_variant ; 1777.0bp to feature; MODIFIER silent_mutation Average:88.683; most accessible tissue: Callus, score: 98.105 N N N N
vg1006723044 C -> CT LOC_Os10g12110.1 downstream_gene_variant ; 2188.0bp to feature; MODIFIER silent_mutation Average:88.683; most accessible tissue: Callus, score: 98.105 N N N N
vg1006723044 C -> CT LOC_Os10g12090-LOC_Os10g12110 intergenic_region ; MODIFIER silent_mutation Average:88.683; most accessible tissue: Callus, score: 98.105 N N N N
vg1006723044 C -> T LOC_Os10g12090.1 upstream_gene_variant ; 1776.0bp to feature; MODIFIER silent_mutation Average:88.683; most accessible tissue: Callus, score: 98.105 N N N N
vg1006723044 C -> T LOC_Os10g12110.1 downstream_gene_variant ; 2189.0bp to feature; MODIFIER silent_mutation Average:88.683; most accessible tissue: Callus, score: 98.105 N N N N
vg1006723044 C -> T LOC_Os10g12090-LOC_Os10g12110 intergenic_region ; MODIFIER silent_mutation Average:88.683; most accessible tissue: Callus, score: 98.105 N N N N
vg1006723044 C -> DEL N N silent_mutation Average:88.683; most accessible tissue: Callus, score: 98.105 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1006723044 C CT 0.18 0.05 0.07 0.2 0.22 0.22
vg1006723044 C T -0.05 -0.02 -0.02 -0.05 -0.05 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006723044 NA 7.98E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006723044 1.77E-06 NA mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006723044 NA 3.56E-08 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006723044 9.57E-06 9.57E-06 mr1173 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006723044 NA 4.57E-12 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006723044 NA 5.61E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006723044 NA 3.18E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006723044 4.62E-06 NA mr1945 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006723044 NA 2.11E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006723044 NA 5.53E-08 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006723044 NA 7.92E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006723044 4.25E-06 4.25E-06 mr1333_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006723044 NA 1.00E-06 mr1438_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006723044 NA 7.57E-06 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251