\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006614973:

Variant ID: vg1006614973 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6614973
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATGACCGCTTATCGGCAAGAGGTACGCAAGTTGGAGGATAAGTTCGTTGGACTCGAACTCACCCATGTTCTTCGGCACAATAACGAAGCAGCTGACAG[G/A]
CTAGCTAATTTTGGTTCAAAACGCGAAGCAGCTCCTTCTGACGTGTTTGTTGAACATCTTTACGAACCAACCGTACCAAGGAAAGAAACAATCGAGGCCA

Reverse complement sequence

TGGCCTCGATTGTTTCTTTCCTTGGTACGGTTGGTTCGTAAAGATGTTCAACAAACACGTCAGAAGGAGCTGCTTCGCGTTTTGAACCAAAATTAGCTAG[C/T]
CTGTCAGCTGCTTCGTTATTGTGCCGAAGAACATGGGTGAGTTCGAGTCCAACGAACTTATCCTCCAACTTGCGTACCTCTTGCCGATAAGCGGTCATGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.40% 0.60% 6.37% 49.64% NA
All Indica  2759 39.70% 0.90% 6.92% 52.48% NA
All Japonica  1512 58.70% 0.00% 0.93% 40.41% NA
Aus  269 5.60% 1.10% 31.97% 61.34% NA
Indica I  595 18.00% 1.00% 8.74% 72.27% NA
Indica II  465 62.40% 0.60% 1.29% 35.70% NA
Indica III  913 37.90% 1.10% 9.31% 51.70% NA
Indica Intermediate  786 44.70% 0.90% 6.11% 48.35% NA
Temperate Japonica  767 89.60% 0.00% 0.13% 10.30% NA
Tropical Japonica  504 11.50% 0.00% 2.38% 86.11% NA
Japonica Intermediate  241 58.90% 0.00% 0.41% 40.66% NA
VI/Aromatic  96 11.50% 0.00% 3.12% 85.42% NA
Intermediate  90 47.80% 0.00% 7.78% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006614973 G -> A LOC_Os10g11920.1 synonymous_variant ; p.Arg688Arg; LOW synonymous_codon Average:9.531; most accessible tissue: Callus, score: 36.421 N N N N
vg1006614973 G -> DEL LOC_Os10g11920.1 N frameshift_variant Average:9.531; most accessible tissue: Callus, score: 36.421 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006614973 NA 9.57E-09 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006614973 NA 6.08E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006614973 NA 2.52E-06 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006614973 NA 2.04E-09 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006614973 NA 2.62E-07 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006614973 2.26E-06 6.49E-09 mr1068_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006614973 7.06E-06 2.06E-11 mr1090_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006614973 NA 1.09E-06 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006614973 NA 6.10E-08 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006614973 8.35E-07 8.35E-07 mr1111_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006614973 NA 4.65E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006614973 NA 1.22E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006614973 4.61E-06 1.79E-07 mr1144_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006614973 NA 6.77E-10 mr1211_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006614973 NA 2.31E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006614973 NA 2.11E-08 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006614973 NA 2.11E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251