\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006601763:

Variant ID: vg1006601763 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6601763
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTAACCAGGGAAGACCATAACCATCTAGGACGGTTTAGCATGACTCTGTGCCAACTGGGCCCTGAGGCTGGTCCGACCAGCCACCAGGCATGACCAGAA[T/C]
GACATTATCTGGTTCGAGATCACGTCGGTCCGACTCGGGGTGTCTAGAATGGCCTGAGACTGTGTAGTATGGCACCTGTCCTGTCTACATGGTTGGTCTG

Reverse complement sequence

CAGACCAACCATGTAGACAGGACAGGTGCCATACTACACAGTCTCAGGCCATTCTAGACACCCCGAGTCGGACCGACGTGATCTCGAACCAGATAATGTC[A/G]
TTCTGGTCATGCCTGGTGGCTGGTCGGACCAGCCTCAGGGCCCAGTTGGCACAGAGTCATGCTAAACCGTCCTAGATGGTTATGGTCTTCCCTGGTTAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.30% 16.70% 0.06% 0.00% NA
All Indica  2759 98.90% 0.90% 0.11% 0.00% NA
All Japonica  1512 51.30% 48.70% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.80% 0.80% 0.34% 0.00% NA
Indica II  465 99.40% 0.40% 0.22% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.40% 0.00% 0.00% NA
Temperate Japonica  767 26.60% 73.40% 0.00% 0.00% NA
Tropical Japonica  504 91.50% 8.50% 0.00% 0.00% NA
Japonica Intermediate  241 45.60% 54.40% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006601763 T -> C LOC_Os10g11889.1 upstream_gene_variant ; 2206.0bp to feature; MODIFIER silent_mutation Average:40.279; most accessible tissue: Callus, score: 94.539 N N N N
vg1006601763 T -> C LOC_Os10g11889.2 upstream_gene_variant ; 2203.0bp to feature; MODIFIER silent_mutation Average:40.279; most accessible tissue: Callus, score: 94.539 N N N N
vg1006601763 T -> C LOC_Os10g11889-LOC_Os10g11910 intergenic_region ; MODIFIER silent_mutation Average:40.279; most accessible tissue: Callus, score: 94.539 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006601763 NA 3.09E-08 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601763 NA 2.58E-07 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601763 NA 1.15E-06 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601763 9.77E-06 6.36E-08 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601763 NA 1.83E-11 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601763 NA 6.94E-10 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601763 2.36E-06 3.76E-08 mr1825_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251