Variant ID: vg1006601763 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 6601763 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCTAACCAGGGAAGACCATAACCATCTAGGACGGTTTAGCATGACTCTGTGCCAACTGGGCCCTGAGGCTGGTCCGACCAGCCACCAGGCATGACCAGAA[T/C]
GACATTATCTGGTTCGAGATCACGTCGGTCCGACTCGGGGTGTCTAGAATGGCCTGAGACTGTGTAGTATGGCACCTGTCCTGTCTACATGGTTGGTCTG
CAGACCAACCATGTAGACAGGACAGGTGCCATACTACACAGTCTCAGGCCATTCTAGACACCCCGAGTCGGACCGACGTGATCTCGAACCAGATAATGTC[A/G]
TTCTGGTCATGCCTGGTGGCTGGTCGGACCAGCCTCAGGGCCCAGTTGGCACAGAGTCATGCTAAACCGTCCTAGATGGTTATGGTCTTCCCTGGTTAGA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 83.30% | 16.70% | 0.06% | 0.00% | NA |
All Indica | 2759 | 98.90% | 0.90% | 0.11% | 0.00% | NA |
All Japonica | 1512 | 51.30% | 48.70% | 0.00% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 98.80% | 0.80% | 0.34% | 0.00% | NA |
Indica II | 465 | 99.40% | 0.40% | 0.22% | 0.00% | NA |
Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 26.60% | 73.40% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 91.50% | 8.50% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 45.60% | 54.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1006601763 | T -> C | LOC_Os10g11889.1 | upstream_gene_variant ; 2206.0bp to feature; MODIFIER | silent_mutation | Average:40.279; most accessible tissue: Callus, score: 94.539 | N | N | N | N |
vg1006601763 | T -> C | LOC_Os10g11889.2 | upstream_gene_variant ; 2203.0bp to feature; MODIFIER | silent_mutation | Average:40.279; most accessible tissue: Callus, score: 94.539 | N | N | N | N |
vg1006601763 | T -> C | LOC_Os10g11889-LOC_Os10g11910 | intergenic_region ; MODIFIER | silent_mutation | Average:40.279; most accessible tissue: Callus, score: 94.539 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1006601763 | NA | 3.09E-08 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1006601763 | NA | 2.58E-07 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1006601763 | NA | 1.15E-06 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1006601763 | 9.77E-06 | 6.36E-08 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1006601763 | NA | 1.83E-11 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1006601763 | NA | 6.94E-10 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1006601763 | 2.36E-06 | 3.76E-08 | mr1825_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |