\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006601193:

Variant ID: vg1006601193 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6601193
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.08, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGTTATGTGGGAGTCGGAAACTTAGAGGGAACAAAAGAAATATAAGGATTGGGAGGCTCCAATTCGAAAGAACAAAGAACATCGACTTTAAATATTTT[T/C]
GCAAAAATTTTACCCTGAAAAATCTAGTATGTTACAGTGGCACAGTTCCAATTTCCCTAAATTCCAGTGGCACGTAACCGATTTCGTGAATAGTAGTGGC

Reverse complement sequence

GCCACTACTATTCACGAAATCGGTTACGTGCCACTGGAATTTAGGGAAATTGGAACTGTGCCACTGTAACATACTAGATTTTTCAGGGTAAAATTTTTGC[A/G]
AAAATATTTAAAGTCGATGTTCTTTGTTCTTTCGAATTGGAGCCTCCCAATCCTTATATTTCTTTTGTTCCCTCTAAGTTTCCGACTCCCACATAACCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.10% 19.80% 0.53% 57.58% NA
All Indica  2759 36.40% 1.60% 0.58% 61.40% NA
All Japonica  1512 0.90% 57.30% 0.26% 41.53% NA
Aus  269 1.10% 0.40% 0.74% 97.77% NA
Indica I  595 10.10% 1.50% 0.84% 87.56% NA
Indica II  465 60.40% 0.90% 0.00% 38.71% NA
Indica III  913 36.60% 1.50% 0.55% 61.34% NA
Indica Intermediate  786 41.90% 2.30% 0.76% 55.09% NA
Temperate Japonica  767 0.40% 88.90% 0.00% 10.69% NA
Tropical Japonica  504 0.40% 10.50% 0.79% 88.29% NA
Japonica Intermediate  241 3.30% 54.80% 0.00% 41.91% NA
VI/Aromatic  96 3.10% 6.20% 0.00% 90.62% NA
Intermediate  90 22.20% 20.00% 3.33% 54.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006601193 T -> C LOC_Os10g11889.1 upstream_gene_variant ; 1636.0bp to feature; MODIFIER silent_mutation Average:20.985; most accessible tissue: Callus, score: 83.559 N N N N
vg1006601193 T -> C LOC_Os10g11889.2 upstream_gene_variant ; 1633.0bp to feature; MODIFIER silent_mutation Average:20.985; most accessible tissue: Callus, score: 83.559 N N N N
vg1006601193 T -> C LOC_Os10g11889-LOC_Os10g11910 intergenic_region ; MODIFIER silent_mutation Average:20.985; most accessible tissue: Callus, score: 83.559 N N N N
vg1006601193 T -> DEL N N silent_mutation Average:20.985; most accessible tissue: Callus, score: 83.559 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006601193 NA 2.29E-06 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601193 NA 1.11E-10 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601193 NA 9.10E-10 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601193 NA 3.89E-07 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601193 NA 9.71E-06 mr1057_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601193 NA 1.63E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601193 NA 3.71E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601193 NA 1.53E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601193 NA 3.00E-06 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601193 NA 4.63E-06 mr1551_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601193 NA 7.51E-06 mr1552_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601193 3.85E-06 8.10E-08 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601193 NA 6.05E-06 mr1660_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601193 NA 8.08E-10 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601193 NA 5.94E-10 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601193 NA 9.14E-06 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601193 4.79E-06 1.42E-07 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006601193 NA 8.80E-09 mr1904_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251