Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1006295271:

Variant ID: vg1006295271 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6295271
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATCCAATCAGATATTTACGATGATAATCCAAACAATTCAAAATAAAAAAAAAGTATCCAATGAGGTAACTGAAAATGAATATTTTCTTTCATTCATAAT[A/C]
CTAATTAAGCAACCTATAAATGGTTATGGTTGGAAACAAAGGGTACTACATATGCCATTTACATGTTCTAGATTCTAAGTGTCTTTTGTATTAATCTGCC

Reverse complement sequence

GGCAGATTAATACAAAAGACACTTAGAATCTAGAACATGTAAATGGCATATGTAGTACCCTTTGTTTCCAACCATAACCATTTATAGGTTGCTTAATTAG[T/G]
ATTATGAATGAAAGAAAATATTCATTTTCAGTTACCTCATTGGATACTTTTTTTTTATTTTGAATTGTTTGGATTATCATCGTAAATATCTGATTGGATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.10% 24.70% 0.21% 0.00% NA
All Indica  2759 98.60% 1.30% 0.18% 0.00% NA
All Japonica  1512 26.80% 73.00% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.00% 0.50% 0.50% 0.00% NA
Indica II  465 98.30% 1.30% 0.43% 0.00% NA
Indica III  913 97.90% 2.10% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 6.00% 93.60% 0.39% 0.00% NA
Tropical Japonica  504 52.40% 47.60% 0.00% 0.00% NA
Japonica Intermediate  241 39.40% 60.60% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 5.20% 1.04% 0.00% NA
Intermediate  90 71.10% 27.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006295271 A -> C LOC_Os10g11354.1 upstream_gene_variant ; 474.0bp to feature; MODIFIER silent_mutation Average:50.231; most accessible tissue: Callus, score: 77.997 N N N N
vg1006295271 A -> C LOC_Os10g11340.1 downstream_gene_variant ; 3531.0bp to feature; MODIFIER silent_mutation Average:50.231; most accessible tissue: Callus, score: 77.997 N N N N
vg1006295271 A -> C LOC_Os10g11340-LOC_Os10g11354 intergenic_region ; MODIFIER silent_mutation Average:50.231; most accessible tissue: Callus, score: 77.997 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006295271 NA 4.06E-09 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006295271 NA 4.99E-06 mr1622 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006295271 NA 4.97E-29 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006295271 NA 1.02E-13 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006295271 NA 3.07E-18 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006295271 NA 2.39E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006295271 NA 3.02E-10 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006295271 8.86E-06 NA mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006295271 NA 2.51E-13 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006295271 NA 3.24E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006295271 NA 8.91E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251