\
| Variant ID: vg1006197301 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 6197301 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 236. )
TTCTTAATTTCTCATTAGCCGATCATAATCAATCTTATCTTATATTTCTCTTTTTGCAGCCTCCTCCTGCTCCCTCTTCTCCTGTTCAACAACCATCAAG[T/C]
AATCAAACTCCATCGGCTGTAGGGAGTCATCATGTTGAAGAAGAGGTTCAACCAGCTGCCCCTGCTATCCCAGTAAGTTTTCTTTGGCACAAATACTGAG
CTCAGTATTTGTGCCAAAGAAAACTTACTGGGATAGCAGGGGCAGCTGGTTGAACCTCTTCTTCAACATGATGACTCCCTACAGCCGATGGAGTTTGATT[A/G]
CTTGATGGTTGTTGAACAGGAGAAGAGGGAGCAGGAGGAGGCTGCAAAAAGAGAAATATAAGATAAGATTGATTATGATCGGCTAATGAGAAATTAAGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.90% | 12.80% | 0.04% | 3.30% | NA |
| All Indica | 2759 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 51.90% | 38.20% | 0.07% | 9.92% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 24.60% | 57.60% | 0.13% | 17.60% | NA |
| Tropical Japonica | 504 | 93.80% | 6.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 50.60% | 43.60% | 0.00% | 5.81% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 84.40% | 13.30% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1006197301 | T -> C | LOC_Os10g11180.1 | synonymous_variant ; p.Ser656Ser; LOW | synonymous_codon | Average:41.933; most accessible tissue: Zhenshan97 young leaf, score: 62.534 | N | N | N | N |
| vg1006197301 | T -> DEL | LOC_Os10g11180.1 | N | frameshift_variant | Average:41.933; most accessible tissue: Zhenshan97 young leaf, score: 62.534 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1006197301 | 5.06E-07 | NA | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197301 | 3.09E-08 | NA | mr1305 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197301 | 7.29E-06 | 9.45E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197301 | NA | 1.20E-07 | mr1364 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197301 | NA | 3.26E-07 | mr1443 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197301 | NA | 5.47E-06 | mr1559 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197301 | 2.76E-07 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197301 | NA | 9.24E-07 | mr1606 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197301 | NA | 2.02E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197301 | 4.05E-06 | 1.43E-19 | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197301 | NA | 2.91E-06 | mr1768 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197301 | 2.39E-07 | 7.01E-31 | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197301 | NA | 2.48E-08 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |