\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006193277:

Variant ID: vg1006193277 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6193277
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:


GGCGCGTCGGCAGCCCAGATGACGACGTCAACGAGGAGGACTGTTGACGTAAAACACGAGGCCTAGGAGATCTGCTTAACTCCAGTGCAGGTCCAAAACT[C/T]
GCCTTCGGGTATGCTAGCGTGCCAGTTGATTTGATCCTGCAATCAACAAGAAACAAAGACAAAGAAACCGCTGTCATATATCTTTGAGCCGATATCATAT

Reverse complement sequence

ATATGATATCGGCTCAAAGATATATGACAGCGGTTTCTTTGTCTTTGTTTCTTGTTGATTGCAGGATCAAATCAACTGGCACGCTAGCATACCCGAAGGC[G/A]
AGTTTTGGACCTGCACTGGAGTTAAGCAGATCTCCTAGGCCTCGTGTTTTACGTCAACAGTCCTCCTCGTTGACGTCGTCATCTGGGCTGCCGACGCGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.50% 17.90% 0.25% 3.34% NA
All Indica  2759 77.90% 21.80% 0.33% 0.00% NA
All Japonica  1512 74.50% 15.30% 0.13% 9.99% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 77.00% 22.40% 0.65% 0.00% NA
Indica III  913 64.10% 35.60% 0.33% 0.00% NA
Indica Intermediate  786 78.90% 20.70% 0.38% 0.00% NA
Temperate Japonica  767 77.40% 4.70% 0.13% 17.73% NA
Tropical Japonica  504 75.60% 24.00% 0.20% 0.20% NA
Japonica Intermediate  241 63.10% 31.10% 0.00% 5.81% NA
VI/Aromatic  96 93.80% 0.00% 1.04% 5.21% NA
Intermediate  90 86.70% 11.10% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006193277 C -> T LOC_Os10g11170.1 upstream_gene_variant ; 4640.0bp to feature; MODIFIER silent_mutation Average:57.39; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N
vg1006193277 C -> T LOC_Os10g11180.1 upstream_gene_variant ; 1665.0bp to feature; MODIFIER silent_mutation Average:57.39; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N
vg1006193277 C -> T LOC_Os10g11170-LOC_Os10g11180 intergenic_region ; MODIFIER silent_mutation Average:57.39; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N
vg1006193277 C -> DEL N N silent_mutation Average:57.39; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006193277 NA 2.22E-06 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 NA 9.42E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 NA 5.52E-07 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 NA 1.70E-14 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 NA 7.75E-08 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 NA 5.34E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 NA 8.32E-09 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 NA 2.44E-14 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 NA 3.55E-06 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 NA 5.93E-12 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 NA 1.64E-09 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 8.80E-06 6.71E-11 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 2.74E-06 1.08E-11 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 NA 2.25E-10 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 NA 1.12E-13 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 NA 1.78E-09 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 3.99E-06 7.17E-13 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 4.95E-06 4.05E-13 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 9.79E-10 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 6.66E-10 2.19E-12 mr1258_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 NA 1.76E-13 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 NA 9.68E-15 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 NA 3.81E-12 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 NA 7.28E-06 mr1866_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006193277 NA 5.68E-07 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251