Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1006139083:

Variant ID: vg1006139083 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 6139083
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, A: 0.29, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:

ATACAAATGCGACAAGTTATGTTAGCATGATATGAGGCAACCAAATAAGAAGCATTAAGAATCAATCATGCTCATCCTATACTAAAGCTCGAACAAGAAG[C/A]
AATAAACCAAAATAGTTTTCCAATTGCGATCAACATAGCGGGCCAAAAGCGTATCAATCGCCGGAACATGAAAATTCAAATAAACCAACACTGCAACTTG

Reverse complement sequence

CAAGTTGCAGTGTTGGTTTATTTGAATTTTCATGTTCCGGCGATTGATACGCTTTTGGCCCGCTATGTTGATCGCAATTGGAAAACTATTTTGGTTTATT[G/T]
CTTCTTGTTCGAGCTTTAGTATAGGATGAGCATGATTGATTCTTAATGCTTCTTATTTGGTTGCCTCATATCATGCTAACATAACTTGTCGCATTTGTAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.00%	32.20%	5.48%	7.32%	NA
All Indica	2759	75.00%	14.80%	7.21%	2.97%	NA
All Japonica	1512	11.40%	68.10%	3.64%	16.93%	NA
Aus	269	98.50%	0.00%	0.74%	0.74%	NA
Indica I	595	97.30%	0.50%	1.51%	0.67%	NA
Indica II	465	72.30%	11.80%	11.61%	4.30%	NA
Indica III	913	60.50%	26.90%	8.32%	4.27%	NA
Indica Intermediate	786	76.60%	13.40%	7.63%	2.42%	NA
Temperate Japonica	767	2.60%	84.60%	1.30%	11.47%	NA
Tropical Japonica	504	25.40%	46.40%	4.96%	23.21%	NA
Japonica Intermediate	241	10.00%	60.60%	8.30%	21.16%	NA
VI/Aromatic	96	55.20%	44.80%	0.00%	0.00%	NA
Intermediate	90	45.60%	44.40%	3.33%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1006139083	C -> A	LOC_Os10g11090.1	downstream_gene_variant ; 2491.0bp to feature; MODIFIER	silent_mutation	Average:26.335; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg1006139083	C -> A	LOC_Os10g11100.1	intron_variant ; MODIFIER	silent_mutation	Average:26.335; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg1006139083	C -> DEL	N	N	silent_mutation	Average:26.335; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1006139083	NA	2.63E-10	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	9.89E-08	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	4.67E-07	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	5.34E-08	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	1.01E-14	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	5.45E-07	4.16E-17	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	1.25E-09	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	5.46E-08	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	4.50E-26	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	2.61E-08	1.92E-19	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	4.12E-07	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	4.53E-08	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	3.08E-06	mr1936	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	8.56E-07	8.56E-07	mr1945	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	2.29E-09	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	5.18E-10	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	2.05E-07	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	4.64E-16	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	8.70E-07	4.45E-17	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	1.85E-07	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	1.74E-10	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	1.27E-09	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	5.55E-06	mr1195_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	1.43E-10	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	9.04E-08	6.27E-10	mr1258_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	1.65E-24	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	2.15E-17	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006139083	NA	3.79E-11	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251