\
| Variant ID: vg1006023292 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 6023292 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 245. )
CCTAGTATTTGGCGCTAGCACCTAGGAGATTTTTCTTTTCTTCCTTTGTGCTTGTCGGAGTCAAATGATTCACCGTAAATACACCCTATGTGTAATTTTC[T/A]
GCTAAATCACTATGATTTTGTTTCGATACTTATTCAGGGAGAGATTCTGATGAGTGAATGTAATAATATGCATCGTAAAATAATTATTATCCATGTTTTT
AAAAACATGGATAATAATTATTTTACGATGCATATTATTACATTCACTCATCAGAATCTCTCCCTGAATAAGTATCGAAACAAAATCATAGTGATTTAGC[A/T]
GAAAATTACACATAGGGTGTATTTACGGTGAATCATTTGACTCCGACAAGCACAAAGGAAGAAAAGAAAAATCTCCTAGGTGCTAGCGCCAAATACTAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 10.10% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 97.70% | 2.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 74.70% | 25.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 41.10% | 58.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.00% | 12.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 77.10% | 21.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1006023292 | T -> A | LOC_Os10g10880.1 | upstream_gene_variant ; 1199.0bp to feature; MODIFIER | silent_mutation | Average:39.164; most accessible tissue: Callus, score: 82.95 | N | N | N | N |
| vg1006023292 | T -> A | LOC_Os10g10870.1 | downstream_gene_variant ; 4108.0bp to feature; MODIFIER | silent_mutation | Average:39.164; most accessible tissue: Callus, score: 82.95 | N | N | N | N |
| vg1006023292 | T -> A | LOC_Os10g10870-LOC_Os10g10880 | intergenic_region ; MODIFIER | silent_mutation | Average:39.164; most accessible tissue: Callus, score: 82.95 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1006023292 | NA | 5.18E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | NA | 5.97E-06 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | NA | 3.21E-07 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | NA | 4.31E-08 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | 6.25E-07 | NA | mr1195_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | 4.25E-06 | 1.70E-06 | mr1195_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | NA | 4.96E-08 | mr1304_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | NA | 1.95E-11 | mr1398_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | NA | 9.94E-07 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | NA | 3.06E-08 | mr1510_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | NA | 1.34E-06 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | NA | 3.79E-07 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | NA | 7.02E-07 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | NA | 8.86E-08 | mr1696_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | NA | 1.17E-06 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | NA | 5.22E-07 | mr1707_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | NA | 2.01E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | NA | 3.35E-06 | mr1819_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | NA | 2.92E-07 | mr1830_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | 7.76E-07 | NA | mr1842_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | NA | 3.25E-06 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006023292 | NA | 3.50E-09 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |