Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005804033:

Variant ID: vg1005804033 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5804033
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.04, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

AATTTGGACTCCTTCCAAATTCGACTCCGCATCCCATACGCACACAATAACTCCATCGTATGCCATATGGAAACTCCATCAACCATGTGCATCAACTCTA[A/G]
CCTAAGTATCCCGCATGATCTCTGACCACCACGGACGTCGTCTTATCCCCAAGTCGACTCCCGGTCCATCACCGCAAATACTCTCCCGAGACATCGAGTC

Reverse complement sequence

GACTCGATGTCTCGGGAGAGTATTTGCGGTGATGGACCGGGAGTCGACTTGGGGATAAGACGACGTCCGTGGTGGTCAGAGATCATGCGGGATACTTAGG[T/C]
TAGAGTTGATGCACATGGTTGATGGAGTTTCCATATGGCATACGATGGAGTTATTGTGTGCGTATGGGATGCGGAGTCGAATTTGGAAGGAGTCCAAATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.30%	28.60%	0.13%	0.00%	NA
All Indica	2759	70.80%	29.10%	0.14%	0.00%	NA
All Japonica	1512	87.80%	12.20%	0.07%	0.00%	NA
Aus	269	1.10%	98.90%	0.00%	0.00%	NA
Indica I	595	89.70%	10.10%	0.17%	0.00%	NA
Indica II	465	70.10%	29.90%	0.00%	0.00%	NA
Indica III	913	66.20%	33.70%	0.11%	0.00%	NA
Indica Intermediate	786	62.20%	37.50%	0.25%	0.00%	NA
Temperate Japonica	767	81.60%	18.40%	0.00%	0.00%	NA
Tropical Japonica	504	97.60%	2.20%	0.20%	0.00%	NA
Japonica Intermediate	241	86.70%	13.30%	0.00%	0.00%	NA
VI/Aromatic	96	25.00%	75.00%	0.00%	0.00%	NA
Intermediate	90	70.00%	28.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005804033	A -> G	LOC_Os10g10520.1	upstream_gene_variant ; 1032.0bp to feature; MODIFIER	silent_mutation	Average:31.763; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N
vg1005804033	A -> G	LOC_Os10g10520-LOC_Os10g10530	intergenic_region ; MODIFIER	silent_mutation	Average:31.763; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005804033	NA	3.37E-06	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005804033	NA	7.50E-06	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005804033	NA	2.08E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005804033	NA	6.03E-08	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005804033	NA	2.23E-07	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005804033	NA	7.99E-11	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005804033	NA	5.43E-07	mr1057_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005804033	NA	1.80E-06	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005804033	9.54E-07	3.45E-11	mr1580_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005804033	NA	1.87E-08	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005804033	NA	8.88E-06	mr1691_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005804033	NA	1.94E-12	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005804033	NA	2.10E-07	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005804033	3.90E-07	1.59E-11	mr1825_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005804033	NA	5.74E-06	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251