\
| Variant ID: vg1005694637 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5694637 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.23, others allele: 0.00, population size: 227. )
AGAGCTGAGGCATGCAAATCAAGCGAAGCTCTACCAAATCATCCAGCTGGTGAAGTACATTTGAGATGCTCCTCAGCATGGTACACTTGAGAGTCAAAAC[A/G]
GCGAGAAACGCCATGGATCCCTGCTGCAAATTCCACTCCTCCAAACCAATATCCATAAGTACCAAACTGCGTAATGCAAGGAATCCCTCGGAAGAACATG
CATGTTCTTCCGAGGGATTCCTTGCATTACGCAGTTTGGTACTTATGGATATTGGTTTGGAGGAGTGGAATTTGCAGCAGGGATCCATGGCGTTTCTCGC[T/C]
GTTTTGACTCTCAAGTGTACCATGCTGAGGAGCATCTCAAATGTACTTCACCAGCTGGATGATTTGGTAGAGCTTCGCTTGATTTGCATGCCTCAGCTCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.70% | 4.30% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.70% | 7.10% | 0.20% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 87.50% | 12.10% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 35.40% | 64.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 14.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005694637 | A -> G | LOC_Os10g10360.1 | synonymous_variant ; p.Ala834Ala; LOW | synonymous_codon | Average:56.479; most accessible tissue: Zhenshan97 young leaf, score: 81.353 | N | N | N | N |
| vg1005694637 | A -> G | LOC_Os10g10360.4 | synonymous_variant ; p.Ala801Ala; LOW | synonymous_codon | Average:56.479; most accessible tissue: Zhenshan97 young leaf, score: 81.353 | N | N | N | N |
| vg1005694637 | A -> G | LOC_Os10g10360.3 | synonymous_variant ; p.Ala834Ala; LOW | synonymous_codon | Average:56.479; most accessible tissue: Zhenshan97 young leaf, score: 81.353 | N | N | N | N |
| vg1005694637 | A -> G | LOC_Os10g10360.2 | synonymous_variant ; p.Ala834Ala; LOW | synonymous_codon | Average:56.479; most accessible tissue: Zhenshan97 young leaf, score: 81.353 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005694637 | 8.09E-12 | NA | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005694637 | 4.54E-06 | 1.56E-09 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005694637 | NA | 5.67E-06 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005694637 | 2.38E-12 | NA | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005694637 | 2.95E-06 | 1.84E-09 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005694637 | 2.68E-07 | 1.50E-12 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005694637 | 1.80E-06 | 7.09E-12 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005694637 | 5.44E-12 | NA | mr1586 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005694637 | NA | 1.09E-08 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005694637 | 8.82E-06 | NA | mr1649 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005694637 | 2.00E-09 | NA | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005694637 | 5.16E-07 | 8.16E-10 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005694637 | 1.48E-08 | 9.69E-14 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005694637 | 6.77E-08 | 4.10E-13 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |