| Variant ID: vg1005631054 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5631054 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 122. )
ATTTTTACTTTTAGCTCGACTATTAAAAAATTTTAAAAGTTACTTAGTAATTTCCGCAGCAAAGCACGGTGAACCACCTAGTTTTTGTAGGGATTTCACT[G/A]
AGCTGAAAGTTTATAGGAAATTTATAGGTTTTTATTTCTATAGGAATTTTTCTGTATAGCCCTTTAAATCAAAGGAATTAATTATATGGAATCCTATGGA
TCCATAGGATTCCATATAATTAATTCCTTTGATTTAAAGGGCTATACAGAAAAATTCCTATAGAAATAAAAACCTATAAATTTCCTATAAACTTTCAGCT[C/T]
AGTGAAATCCCTACAAAAACTAGGTGGTTCACCGTGCTTTGCTGCGGAAATTACTAAGTAACTTTTAAAATTTTTTAATAGTCGAGCTAAAAGTAAAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.10% | 20.80% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 71.80% | 28.00% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 87.30% | 12.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 70.30% | 29.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 65.30% | 34.30% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 65.60% | 34.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005631054 | G -> A | LOC_Os10g10244.1 | upstream_gene_variant ; 1193.0bp to feature; MODIFIER | silent_mutation | Average:36.838; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1005631054 | G -> A | LOC_Os10g10230.1 | downstream_gene_variant ; 1945.0bp to feature; MODIFIER | silent_mutation | Average:36.838; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1005631054 | G -> A | LOC_Os10g10230-LOC_Os10g10244 | intergenic_region ; MODIFIER | silent_mutation | Average:36.838; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005631054 | 4.96E-07 | 6.82E-13 | mr1027_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005631054 | NA | 1.04E-06 | mr1057_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005631054 | NA | 1.24E-10 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005631054 | NA | 1.65E-06 | mr1691_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005631054 | NA | 9.53E-06 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005631054 | 3.05E-06 | 2.30E-11 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005631054 | NA | 8.18E-07 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |