\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005631054:

Variant ID: vg1005631054 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5631054
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTTACTTTTAGCTCGACTATTAAAAAATTTTAAAAGTTACTTAGTAATTTCCGCAGCAAAGCACGGTGAACCACCTAGTTTTTGTAGGGATTTCACT[G/A]
AGCTGAAAGTTTATAGGAAATTTATAGGTTTTTATTTCTATAGGAATTTTTCTGTATAGCCCTTTAAATCAAAGGAATTAATTATATGGAATCCTATGGA

Reverse complement sequence

TCCATAGGATTCCATATAATTAATTCCTTTGATTTAAAGGGCTATACAGAAAAATTCCTATAGAAATAAAAACCTATAAATTTCCTATAAACTTTCAGCT[C/T]
AGTGAAATCCCTACAAAAACTAGGTGGTTCACCGTGCTTTGCTGCGGAAATTACTAAGTAACTTTTAAAATTTTTTAATAGTCGAGCTAAAAGTAAAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.10% 20.80% 0.11% 0.00% NA
All Indica  2759 71.80% 28.00% 0.18% 0.00% NA
All Japonica  1512 87.30% 12.70% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 91.10% 8.90% 0.00% 0.00% NA
Indica II  465 70.30% 29.70% 0.00% 0.00% NA
Indica III  913 65.30% 34.30% 0.44% 0.00% NA
Indica Intermediate  786 65.60% 34.20% 0.13% 0.00% NA
Temperate Japonica  767 94.30% 5.70% 0.00% 0.00% NA
Tropical Japonica  504 74.40% 25.60% 0.00% 0.00% NA
Japonica Intermediate  241 92.10% 7.90% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005631054 G -> A LOC_Os10g10244.1 upstream_gene_variant ; 1193.0bp to feature; MODIFIER silent_mutation Average:36.838; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg1005631054 G -> A LOC_Os10g10230.1 downstream_gene_variant ; 1945.0bp to feature; MODIFIER silent_mutation Average:36.838; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg1005631054 G -> A LOC_Os10g10230-LOC_Os10g10244 intergenic_region ; MODIFIER silent_mutation Average:36.838; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005631054 4.96E-07 6.82E-13 mr1027_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005631054 NA 1.04E-06 mr1057_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005631054 NA 1.24E-10 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005631054 NA 1.65E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005631054 NA 9.53E-06 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005631054 3.05E-06 2.30E-11 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005631054 NA 8.18E-07 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251