\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005357442:

Variant ID: vg1005357442 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 5357442
Reference Allele: GAlternative Allele: T,GAA,GA,A
Primary Allele: TSecondary Allele: GA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTATTCCGCGCGCATGTTTTTAATAATGCTAAACGGTGTGTCTTTTGCAAAATATTTCTAAACGAAAGTTGCTTAAAAAAATTATATTAATCTATTTTT[G/T,GAA,GA,A]
AAAAAAAAATTAGCTAATACTTAATTAATCACACGCTAATAAACCGCTCCGTTTTCATGCACGAACACCGTCGACGAGAAGGCGAGTTGGAAATCAGAAC

Reverse complement sequence

GTTCTGATTTCCAACTCGCCTTCTCGTCGACGGTGTTCGTGCATGAAAACGGAGCGGTTTATTAGCGTGTGATTAATTAAGTATTAGCTAATTTTTTTTT[C/A,TTC,TC,T]
AAAAATAGATTAATATAATTTTTTTAAGCAACTTTCGTTTAGAAATATTTTGCAAAAGACACACCGTTTAGCATTATTAAAAACATGCGCGCGGAATACG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of GA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.10% 21.90% 3.47% 7.60% G: 19.57%; GAA: 4.34%; A: 0.04%
All Indica  2759 56.70% 28.50% 1.78% 2.65% GAA: 6.92%; G: 3.55%
All Japonica  1512 26.80% 15.30% 3.37% 2.25% G: 51.46%; GAA: 0.66%; A: 0.13%
Aus  269 5.90% 0.00% 10.78% 82.16% G: 1.12%
Indica I  595 56.00% 25.00% 2.69% 1.68% GAA: 11.09%; G: 3.53%
Indica II  465 68.60% 16.10% 0.43% 0.86% GAA: 12.26%; G: 1.72%
Indica III  913 56.80% 33.30% 0.77% 2.19% G: 5.59%; GAA: 1.31%
Indica Intermediate  786 49.90% 32.70% 3.05% 4.96% GAA: 7.12%; G: 2.29%
Temperate Japonica  767 11.20% 13.30% 5.87% 2.74% G: 65.71%; GAA: 1.17%
Tropical Japonica  504 41.50% 22.80% 0.60% 1.59% G: 33.13%; A: 0.40%
Japonica Intermediate  241 45.60% 6.20% 1.24% 2.07% G: 44.40%; GAA: 0.41%
VI/Aromatic  96 22.90% 4.20% 28.12% 20.83% G: 23.96%
Intermediate  90 35.60% 13.30% 8.89% 12.22% G: 25.56%; GAA: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005357442 G -> T LOC_Os10g09890.1 upstream_gene_variant ; 3299.0bp to feature; MODIFIER silent_mutation Average:60.388; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg1005357442 G -> T LOC_Os10g09880.1 downstream_gene_variant ; 4512.0bp to feature; MODIFIER silent_mutation Average:60.388; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg1005357442 G -> T LOC_Os10g09900.1 downstream_gene_variant ; 4487.0bp to feature; MODIFIER silent_mutation Average:60.388; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg1005357442 G -> T LOC_Os10g09880-LOC_Os10g09890 intergenic_region ; MODIFIER silent_mutation Average:60.388; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg1005357442 G -> DEL N N silent_mutation Average:60.388; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg1005357442 G -> GA LOC_Os10g09890.1 upstream_gene_variant ; 3298.0bp to feature; MODIFIER silent_mutation Average:60.388; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg1005357442 G -> GA LOC_Os10g09880.1 downstream_gene_variant ; 4513.0bp to feature; MODIFIER silent_mutation Average:60.388; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg1005357442 G -> GA LOC_Os10g09900.1 downstream_gene_variant ; 4486.0bp to feature; MODIFIER silent_mutation Average:60.388; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg1005357442 G -> GA LOC_Os10g09880-LOC_Os10g09890 intergenic_region ; MODIFIER silent_mutation Average:60.388; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg1005357442 G -> GAA LOC_Os10g09890.1 upstream_gene_variant ; 3298.0bp to feature; MODIFIER silent_mutation Average:60.388; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg1005357442 G -> GAA LOC_Os10g09880.1 downstream_gene_variant ; 4513.0bp to feature; MODIFIER silent_mutation Average:60.388; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg1005357442 G -> GAA LOC_Os10g09900.1 downstream_gene_variant ; 4486.0bp to feature; MODIFIER silent_mutation Average:60.388; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg1005357442 G -> GAA LOC_Os10g09880-LOC_Os10g09890 intergenic_region ; MODIFIER silent_mutation Average:60.388; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg1005357442 G -> A LOC_Os10g09890.1 upstream_gene_variant ; 3299.0bp to feature; MODIFIER silent_mutation Average:60.388; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg1005357442 G -> A LOC_Os10g09880.1 downstream_gene_variant ; 4512.0bp to feature; MODIFIER silent_mutation Average:60.388; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg1005357442 G -> A LOC_Os10g09900.1 downstream_gene_variant ; 4487.0bp to feature; MODIFIER silent_mutation Average:60.388; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg1005357442 G -> A LOC_Os10g09880-LOC_Os10g09890 intergenic_region ; MODIFIER silent_mutation Average:60.388; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1005357442 G A 0.02 0.01 0.01 0.01 0.02 0.03
vg1005357442 G GA 0.1 0.02 0.01 0.03 -0.04 -0.11
vg1005357442 G GAA 0.22 0.04 0.03 0.08 0.03 -0.06
vg1005357442 G T 0.02 0.0 0.0 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005357442 3.97E-06 NA mr1131 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005357442 NA 8.06E-06 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005357442 NA 5.07E-11 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251