\
| Variant ID: vg1005356435 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5356435 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 113. )
ATTAGTAGTGAAAAAACTACTACTCCCTCCGTAATAATATGCAGCTCTCTTTATTTAAAACATCATACTTTTATAGATATTGTTGGTTAAAGTAGCATTT[T/C]
AAAAACCGTGTCAAGGTCTAAAAATGTTTATATTTTATGACGGAGGAAGTACATAATTAGTTGTGAAGTTATCACATAGAAGAGAAAATTTGATTGGTAG
CTACCAATCAAATTTTCTCTTCTATGTGATAACTTCACAACTAATTATGTACTTCCTCCGTCATAAAATATAAACATTTTTAGACCTTGACACGGTTTTT[A/G]
AAATGCTACTTTAACCAACAATATCTATAAAAGTATGATGTTTTAAATAAAGAGAGCTGCATATTATTACGGAGGGAGTAGTAGTTTTTTCACTACTAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.10% | 40.10% | 0.83% | 0.00% | NA |
| All Indica | 2759 | 62.20% | 37.40% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 47.00% | 52.80% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 59.30% | 40.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 69.90% | 29.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 64.30% | 35.40% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 57.40% | 41.90% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 33.20% | 66.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 66.30% | 33.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.60% | 48.10% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 54.20% | 24.00% | 21.88% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 43.30% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005356435 | T -> C | LOC_Os10g09890.1 | upstream_gene_variant ; 4306.0bp to feature; MODIFIER | silent_mutation | Average:44.743; most accessible tissue: Callus, score: 86.742 | N | N | N | N |
| vg1005356435 | T -> C | LOC_Os10g09880.1 | downstream_gene_variant ; 3505.0bp to feature; MODIFIER | silent_mutation | Average:44.743; most accessible tissue: Callus, score: 86.742 | N | N | N | N |
| vg1005356435 | T -> C | LOC_Os10g09880-LOC_Os10g09890 | intergenic_region ; MODIFIER | silent_mutation | Average:44.743; most accessible tissue: Callus, score: 86.742 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005356435 | 1.23E-06 | NA | mr1768 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005356435 | NA | 5.12E-10 | mr1768 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005356435 | 1.91E-07 | NA | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005356435 | NA | 1.55E-11 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |