\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005356435:

Variant ID: vg1005356435 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5356435
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAGTAGTGAAAAAACTACTACTCCCTCCGTAATAATATGCAGCTCTCTTTATTTAAAACATCATACTTTTATAGATATTGTTGGTTAAAGTAGCATTT[T/C]
AAAAACCGTGTCAAGGTCTAAAAATGTTTATATTTTATGACGGAGGAAGTACATAATTAGTTGTGAAGTTATCACATAGAAGAGAAAATTTGATTGGTAG

Reverse complement sequence

CTACCAATCAAATTTTCTCTTCTATGTGATAACTTCACAACTAATTATGTACTTCCTCCGTCATAAAATATAAACATTTTTAGACCTTGACACGGTTTTT[A/G]
AAATGCTACTTTAACCAACAATATCTATAAAAGTATGATGTTTTAAATAAAGAGAGCTGCATATTATTACGGAGGGAGTAGTAGTTTTTTCACTACTAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 40.10% 0.83% 0.00% NA
All Indica  2759 62.20% 37.40% 0.40% 0.00% NA
All Japonica  1512 47.00% 52.80% 0.20% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 59.30% 40.50% 0.17% 0.00% NA
Indica II  465 69.90% 29.90% 0.22% 0.00% NA
Indica III  913 64.30% 35.40% 0.33% 0.00% NA
Indica Intermediate  786 57.40% 41.90% 0.76% 0.00% NA
Temperate Japonica  767 33.20% 66.80% 0.00% 0.00% NA
Tropical Japonica  504 66.30% 33.70% 0.00% 0.00% NA
Japonica Intermediate  241 50.60% 48.10% 1.24% 0.00% NA
VI/Aromatic  96 54.20% 24.00% 21.88% 0.00% NA
Intermediate  90 52.20% 43.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005356435 T -> C LOC_Os10g09890.1 upstream_gene_variant ; 4306.0bp to feature; MODIFIER silent_mutation Average:44.743; most accessible tissue: Callus, score: 86.742 N N N N
vg1005356435 T -> C LOC_Os10g09880.1 downstream_gene_variant ; 3505.0bp to feature; MODIFIER silent_mutation Average:44.743; most accessible tissue: Callus, score: 86.742 N N N N
vg1005356435 T -> C LOC_Os10g09880-LOC_Os10g09890 intergenic_region ; MODIFIER silent_mutation Average:44.743; most accessible tissue: Callus, score: 86.742 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005356435 1.23E-06 NA mr1768 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005356435 NA 5.12E-10 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005356435 1.91E-07 NA mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005356435 NA 1.55E-11 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251