\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005292809:

Variant ID: vg1005292809 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5292809
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


CCGAGAGAGTGATCCTTTCCGAAATCGCTAATAGGCGATCAATCGCATGCGCCCTCCCCATGCGACTAGACACGCGTCGTGCGCTGAGGGGGCGGGGCGC[G/A]
GGTGGCGTGCGTTTTTTTTTGTTTTTTTCGCACGGTTTCTGGGCGGCATGCGTTTTTTTTTCTTTTTATACGCACAGTTTTTTTTTCTTTTCTTCTTTTA

Reverse complement sequence

TAAAAGAAGAAAAGAAAAAAAAACTGTGCGTATAAAAAGAAAAAAAAACGCATGCCGCCCAGAAACCGTGCGAAAAAAACAAAAAAAAACGCACGCCACC[C/T]
GCGCCCCGCCCCCTCAGCGCACGACGCGTGTCTAGTCGCATGGGGAGGGCGCATGCGATTGATCGCCTATTAGCGATTTCGGAAAGGATCACTCTCTCGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.70% 7.90% 8.00% 3.39% NA
All Indica  2759 78.30% 5.50% 13.30% 2.94% NA
All Japonica  1512 82.40% 14.00% 0.33% 3.24% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 81.70% 0.00% 16.30% 2.02% NA
Indica II  465 72.50% 12.00% 12.90% 2.58% NA
Indica III  913 81.40% 7.60% 8.76% 2.30% NA
Indica Intermediate  786 75.60% 3.30% 16.54% 4.58% NA
Temperate Japonica  767 88.30% 5.90% 0.52% 5.35% NA
Tropical Japonica  504 79.60% 19.60% 0.20% 0.60% NA
Japonica Intermediate  241 69.70% 28.20% 0.00% 2.07% NA
VI/Aromatic  96 68.80% 6.20% 0.00% 25.00% NA
Intermediate  90 83.30% 4.40% 5.56% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005292809 G -> A LOC_Os10g09790.1 upstream_gene_variant ; 1920.0bp to feature; MODIFIER silent_mutation Average:41.408; most accessible tissue: Callus, score: 77.125 N N N N
vg1005292809 G -> A LOC_Os10g09780.1 downstream_gene_variant ; 1728.0bp to feature; MODIFIER silent_mutation Average:41.408; most accessible tissue: Callus, score: 77.125 N N N N
vg1005292809 G -> A LOC_Os10g09780-LOC_Os10g09790 intergenic_region ; MODIFIER silent_mutation Average:41.408; most accessible tissue: Callus, score: 77.125 N N N N
vg1005292809 G -> DEL N N silent_mutation Average:41.408; most accessible tissue: Callus, score: 77.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005292809 NA 2.12E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005292809 NA 4.61E-13 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005292809 NA 1.76E-11 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005292809 NA 1.96E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005292809 NA 8.82E-13 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005292809 NA 9.29E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005292809 NA 4.95E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005292809 NA 3.59E-07 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005292809 NA 2.28E-10 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005292809 4.06E-06 1.01E-06 mr1906 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005292809 NA 8.91E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005292809 NA 8.07E-08 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005292809 NA 7.06E-06 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251