\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005269476:

Variant ID: vg1005269476 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5269476
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTGAAAACCCTACCGTCATTCTATGATCTTTAGTCCCGATTCATCCCTTGTCAGATGTATGTCATGGGGCCGAGGATCTTTAGTCCCGGTTGCTGTCAC[C/T]
AACCGGGACTAAAGAGATTACCACTTTATTCACGGCTGGTATTACCAACCGGGACTAAAGATCTTAGTTTGGTATTATCAACCGGCGCTAAAATTGAACG

Reverse complement sequence

CGTTCAATTTTAGCGCCGGTTGATAATACCAAACTAAGATCTTTAGTCCCGGTTGGTAATACCAGCCGTGAATAAAGTGGTAATCTCTTTAGTCCCGGTT[G/A]
GTGACAGCAACCGGGACTAAAGATCCTCGGCCCCATGACATACATCTGACAAGGGATGAATCGGGACTAAAGATCATAGAATGACGGTAGGGTTTTCAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.90% 2.30% 0.89% 3.94% NA
All Indica  2759 94.40% 3.90% 1.34% 0.36% NA
All Japonica  1512 90.10% 0.00% 0.26% 9.66% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 93.60% 3.40% 3.03% 0.00% NA
Indica II  465 89.50% 8.80% 1.72% 0.00% NA
Indica III  913 98.10% 1.00% 0.22% 0.66% NA
Indica Intermediate  786 93.60% 4.70% 1.15% 0.51% NA
Temperate Japonica  767 83.20% 0.00% 0.52% 16.30% NA
Tropical Japonica  504 99.20% 0.00% 0.00% 0.79% NA
Japonica Intermediate  241 92.90% 0.00% 0.00% 7.05% NA
VI/Aromatic  96 76.00% 0.00% 0.00% 23.96% NA
Intermediate  90 91.10% 1.10% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005269476 C -> T LOC_Os10g09740.1 intron_variant ; MODIFIER silent_mutation Average:47.647; most accessible tissue: Minghui63 young leaf, score: 68.07 N N N N
vg1005269476 C -> DEL N N silent_mutation Average:47.647; most accessible tissue: Minghui63 young leaf, score: 68.07 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005269476 NA 1.01E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476 NA 5.18E-06 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476 NA 3.24E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476 NA 8.10E-06 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476 NA 2.68E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476 NA 4.68E-06 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476 6.25E-06 7.24E-07 mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476 NA 3.04E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476 2.90E-06 7.21E-10 mr1053_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476 7.51E-06 1.45E-08 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476 NA 4.16E-08 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476 NA 6.62E-07 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476 NA 2.52E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476 NA 2.06E-07 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251