Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005269476:

Variant ID: vg1005269476 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5269476
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTGAAAACCCTACCGTCATTCTATGATCTTTAGTCCCGATTCATCCCTTGTCAGATGTATGTCATGGGGCCGAGGATCTTTAGTCCCGGTTGCTGTCAC[C/T]
AACCGGGACTAAAGAGATTACCACTTTATTCACGGCTGGTATTACCAACCGGGACTAAAGATCTTAGTTTGGTATTATCAACCGGCGCTAAAATTGAACG

Reverse complement sequence

CGTTCAATTTTAGCGCCGGTTGATAATACCAAACTAAGATCTTTAGTCCCGGTTGGTAATACCAGCCGTGAATAAAGTGGTAATCTCTTTAGTCCCGGTT[G/A]
GTGACAGCAACCGGGACTAAAGATCCTCGGCCCCATGACATACATCTGACAAGGGATGAATCGGGACTAAAGATCATAGAATGACGGTAGGGTTTTCAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.90%	2.30%	0.89%	3.94%	NA
All Indica	2759	94.40%	3.90%	1.34%	0.36%	NA
All Japonica	1512	90.10%	0.00%	0.26%	9.66%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	93.60%	3.40%	3.03%	0.00%	NA
Indica II	465	89.50%	8.80%	1.72%	0.00%	NA
Indica III	913	98.10%	1.00%	0.22%	0.66%	NA
Indica Intermediate	786	93.60%	4.70%	1.15%	0.51%	NA
Temperate Japonica	767	83.20%	0.00%	0.52%	16.30%	NA
Tropical Japonica	504	99.20%	0.00%	0.00%	0.79%	NA
Japonica Intermediate	241	92.90%	0.00%	0.00%	7.05%	NA
VI/Aromatic	96	76.00%	0.00%	0.00%	23.96%	NA
Intermediate	90	91.10%	1.10%	1.11%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005269476	C -> T	LOC_Os10g09740.1	intron_variant ; MODIFIER	silent_mutation	Average:47.647; most accessible tissue: Minghui63 young leaf, score: 68.07	N	N	N	N
vg1005269476	C -> DEL	N	N	silent_mutation	Average:47.647; most accessible tissue: Minghui63 young leaf, score: 68.07	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005269476	NA	1.01E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476	NA	5.18E-06	mr1053	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476	NA	3.24E-06	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476	NA	8.10E-06	mr1076	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476	NA	2.68E-06	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476	NA	4.68E-06	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476	6.25E-06	7.24E-07	mr1204	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476	NA	3.04E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476	2.90E-06	7.21E-10	mr1053_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476	7.51E-06	1.45E-08	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476	NA	4.16E-08	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476	NA	6.62E-07	mr1147_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476	NA	2.52E-06	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005269476	NA	2.06E-07	mr1264_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251