Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004952643:

Variant ID: vg1004952643 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 4952643
Reference Allele: CAlternative Allele: T,CTTT
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGGACGGATCTGATGCGCGCGTTGTATTGTAAGGCCGGCGCTCGATCGGCTCGGCTTGGTAGAGATGCAGGTTCTAGGGTGGGCCCCGTGCCAACTAGT[C/T,CTTT]
CGATGGGATGGGTTCTAAAAGATGCCAGTTTTTTTTTTACAACCGGCCTCTATATCTGACAGGAGTAAAAGGTGCTGGTACCTTTTAGGTGACAAAGGTG

Reverse complement sequence

CACCTTTGTCACCTAAAAGGTACCAGCACCTTTTACTCCTGTCAGATATAGAGGCCGGTTGTAAAAAAAAAACTGGCATCTTTTAGAACCCATCCCATCG[G/A,AAAG]
ACTAGTTGGCACGGGGCCCACCCTAGAACCTGCATCTCTACCAAGCCGAGCCGATCGAGCGCCGGCCTTACAATACAACGCGCGCATCAGATCCGTCCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.20% 1.60% 3.62% 0.59% CTTT: 0.02%
All Indica  2759 97.20% 1.70% 0.43% 0.65% NA
All Japonica  1512 87.40% 1.80% 10.05% 0.66% CTTT: 0.07%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.10% 0.40% 0.43% 1.08% NA
Indica III  913 94.00% 4.20% 0.55% 1.31% NA
Indica Intermediate  786 98.30% 0.90% 0.64% 0.13% NA
Temperate Japonica  767 79.70% 1.40% 18.64% 0.26% NA
Tropical Japonica  504 98.40% 0.20% 0.60% 0.79% NA
Japonica Intermediate  241 89.20% 6.20% 2.49% 1.66% CTTT: 0.41%
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 93.30% 0.00% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004952643 C -> T LOC_Os10g09180.1 upstream_gene_variant ; 4578.0bp to feature; MODIFIER silent_mutation Average:81.677; most accessible tissue: Minghui63 flag leaf, score: 95.473 N N N N
vg1004952643 C -> T LOC_Os10g09160.1 downstream_gene_variant ; 4238.0bp to feature; MODIFIER silent_mutation Average:81.677; most accessible tissue: Minghui63 flag leaf, score: 95.473 N N N N
vg1004952643 C -> T LOC_Os10g09170.1 intron_variant ; MODIFIER silent_mutation Average:81.677; most accessible tissue: Minghui63 flag leaf, score: 95.473 N N N N
vg1004952643 C -> CTTT LOC_Os10g09180.1 upstream_gene_variant ; 4577.0bp to feature; MODIFIER silent_mutation Average:81.677; most accessible tissue: Minghui63 flag leaf, score: 95.473 N N N N
vg1004952643 C -> CTTT LOC_Os10g09160.1 downstream_gene_variant ; 4239.0bp to feature; MODIFIER silent_mutation Average:81.677; most accessible tissue: Minghui63 flag leaf, score: 95.473 N N N N
vg1004952643 C -> CTTT LOC_Os10g09170.1 intron_variant ; MODIFIER silent_mutation Average:81.677; most accessible tissue: Minghui63 flag leaf, score: 95.473 N N N N
vg1004952643 C -> DEL N N silent_mutation Average:81.677; most accessible tissue: Minghui63 flag leaf, score: 95.473 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1004952643 C CTTT -0.2 -0.05 -0.05 -0.15 -0.13 -0.12
vg1004952643 C T -0.02 -0.04 -0.02 -0.04 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004952643 2.30E-08 NA mr1210 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004952643 NA 8.00E-09 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004952643 4.14E-10 NA mr1300 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004952643 4.84E-06 7.86E-08 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004952643 1.51E-08 NA mr1305 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004952643 NA 3.14E-09 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004952643 1.88E-07 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004952643 1.81E-06 NA mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004952643 NA 7.31E-11 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004952643 8.26E-07 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004952643 NA 1.37E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004952643 NA 6.79E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004952643 9.54E-09 NA mr1926 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004952643 5.51E-10 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004952643 1.08E-06 9.56E-10 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004952643 1.35E-06 NA mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004952643 NA 8.76E-07 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004952643 2.17E-10 9.62E-11 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004952643 1.17E-06 2.87E-12 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004952643 NA 2.17E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251