\
| Variant ID: vg1004851571 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4851571 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CACATCTACATGACCATTTGAAAATTTGCACATTGAGAAAGATCAAGATGGGGCCAAAGACACTTGCACAATCTTCATTGAGGTTCAATTCCATAGAGGG[A/G]
GGGAAAGTTTCTGTGGACACATACACATTTGATCCAGCAGTGGCTAGGAGAGAGCTTGCTGCCATGATAATATTACATGAGTATCCTTTATCTATTGTTG
CAACAATAGATAAAGGATACTCATGTAATATTATCATGGCAGCAAGCTCTCTCCTAGCCACTGCTGGATCAAATGTGTATGTGTCCACAGAAACTTTCCC[T/C]
CCCTCTATGGAATTGAACCTCAATGAAGATTGTGCAAGTGTCTTTGGCCCCATCTTGATCTTTCTCAATGTGCAAATTTTCAAATGGTCATGTAGATGTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.60% | 6.20% | 35.48% | 17.73% | NA |
| All Indica | 2759 | 9.50% | 10.50% | 57.27% | 22.76% | NA |
| All Japonica | 1512 | 88.20% | 0.10% | 3.11% | 8.60% | NA |
| Aus | 269 | 81.80% | 0.40% | 3.35% | 14.50% | NA |
| Indica I | 595 | 6.10% | 6.10% | 55.29% | 32.61% | NA |
| Indica II | 465 | 12.30% | 4.90% | 39.14% | 43.66% | NA |
| Indica III | 913 | 10.70% | 15.40% | 67.91% | 5.91% | NA |
| Indica Intermediate | 786 | 9.00% | 11.30% | 57.12% | 22.52% | NA |
| Temperate Japonica | 767 | 96.70% | 0.00% | 1.56% | 1.69% | NA |
| Tropical Japonica | 504 | 75.20% | 0.20% | 5.36% | 19.25% | NA |
| Japonica Intermediate | 241 | 88.40% | 0.00% | 3.32% | 8.30% | NA |
| VI/Aromatic | 96 | 60.40% | 0.00% | 20.83% | 18.75% | NA |
| Intermediate | 90 | 48.90% | 2.20% | 23.33% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004851571 | A -> G | LOC_Os10g08970.1 | synonymous_variant ; p.Gly207Gly; LOW | synonymous_codon | Average:8.869; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg1004851571 | A -> DEL | LOC_Os10g08970.1 | N | frameshift_variant | Average:8.869; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004851571 | NA | 7.76E-10 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004851571 | NA | 3.03E-10 | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004851571 | NA | 1.63E-10 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004851571 | NA | 1.66E-11 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004851571 | 7.85E-06 | 6.99E-15 | mr1390 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004851571 | NA | 6.11E-15 | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004851571 | NA | 4.43E-07 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004851571 | NA | 3.66E-14 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004851571 | NA | 1.55E-06 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |