\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004675667:

Variant ID: vg1004675667 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4675667
Reference Allele: TAlternative Allele: C,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, T: 0.33, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GCTGCTCCCGCCACCGCCATACGTCCGCGATTACGCCTACAGCCAGAGACGCCATCGAATCACATCCTATGCCGTGGTTGCCGGCGATGACGACGGTTCG[T/C,G]
GGCGCATCCTCGTATCGGCTGAGGACGCAGGAACCTACTGTTTGGACGTGGCCAGCAACATGTGGAGTCGAGTGGGCGAGTGGACGCTACCCTTCTTGGG

Reverse complement sequence

CCCAAGAAGGGTAGCGTCCACTCGCCCACTCGACTCCACATGTTGCTGGCCACGTCCAAACAGTAGGTTCCTGCGTCCTCAGCCGATACGAGGATGCGCC[A/G,C]
CGAACCGTCGTCATCGCCGGCAACCACGGCATAGGATGTGATTCGATGGCGTCTCTGGCTGTAGGCGTAATCGCGGACGTATGGCGGTGGCGGGAGCAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.30% 46.20% 0.21% 0.32% G: 3.00%
All Indica  2759 55.50% 39.70% 0.18% 0.47% G: 4.13%
All Japonica  1512 32.80% 66.90% 0.13% 0.00% G: 0.20%
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 59.30% 40.30% 0.17% 0.17% NA
Indica II  465 52.30% 45.60% 0.22% 1.08% G: 0.86%
Indica III  913 51.70% 38.30% 0.22% 0.44% G: 9.31%
Indica Intermediate  786 58.90% 37.40% 0.13% 0.38% G: 3.18%
Temperate Japonica  767 22.30% 77.70% 0.00% 0.00% NA
Tropical Japonica  504 37.30% 62.50% 0.20% 0.00% NA
Japonica Intermediate  241 56.80% 41.50% 0.41% 0.00% G: 1.24%
VI/Aromatic  96 52.10% 24.00% 2.08% 0.00% G: 21.88%
Intermediate  90 38.90% 53.30% 1.11% 2.22% G: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004675667 T -> C LOC_Os10g08610.1 missense_variant ; p.Trp240Arg; MODERATE nonsynonymous_codon ; W240R Average:81.285; most accessible tissue: Zhenshan97 young leaf, score: 93.276 unknown unknown TOLERATED 0.26
vg1004675667 T -> G LOC_Os10g08610.1 missense_variant ; p.Trp240Gly; MODERATE nonsynonymous_codon ; W240G Average:81.285; most accessible tissue: Zhenshan97 young leaf, score: 93.276 unknown unknown TOLERATED 0.14
vg1004675667 T -> DEL LOC_Os10g08610.1 N frameshift_variant Average:81.285; most accessible tissue: Zhenshan97 young leaf, score: 93.276 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1004675667 T C -0.01 0.01 0.01 0.0 0.01 0.01
vg1004675667 T G -0.01 0.01 0.01 0.01 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004675667 1.84E-06 5.59E-06 mr1708 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004675667 NA 6.11E-06 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004675667 5.51E-07 NA mr1691_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004675667 NA 1.53E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251