Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1004625809:

Variant ID: vg1004625809 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 4625809
Reference Allele: G	Alternative Allele: A,GTCGTTTCGCCA
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

CCCTACCACCCAAATTCCGGCTGTAGCCACCGTCGGCTGCGCGTCACCCACGTCTCGCCACCAATCCCGCTCTACGTGCGTCACTTCGTGTCGCGTCGCC[G/A,GTCGTTTCGCCA]
TCGAATCGCCACCAGTGCATGACGCCAAGTCTTCACGTCGCCGTCCCCTCCTCCCAGGAATCCCATGTCTTCTCTTCCGACCGCCGAGGAGTATCTCCAG

Reverse complement sequence

CTGGAGATACTCCTCGGCGGTCGGAAGAGAAGACATGGGATTCCTGGGAGGAGGGGACGGCGACGTGAAGACTTGGCGTCATGCACTGGTGGCGATTCGA[C/T,TGGCGAAACGAC]
GGCGACGCGACACGAAGTGACGCACGTAGAGCGGGATTGGTGGCGAGACGTGGGTGACGCGCAGCCGACGGTGGCTACAGCCGGAATTTGGGTGGTAGGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.60%	28.30%	0.57%	39.44%	GTCGTTTCGCCA: 0.04%
All Indica	2759	41.90%	2.30%	0.65%	55.09%	NA
All Japonica	1512	18.90%	79.20%	0.20%	1.72%	NA
Aus	269	4.50%	1.50%	1.12%	92.94%	NA
Indica I	595	40.80%	1.50%	1.18%	56.47%	NA
Indica II	465	37.80%	1.50%	0.65%	60.00%	NA
Indica III	913	49.30%	1.90%	0.22%	48.63%	NA
Indica Intermediate	786	36.60%	3.90%	0.76%	58.65%	NA
Temperate Japonica	767	6.10%	93.10%	0.26%	0.52%	NA
Tropical Japonica	504	32.90%	64.90%	0.20%	1.98%	NA
Japonica Intermediate	241	30.30%	64.70%	0.00%	4.98%	NA
VI/Aromatic	96	14.60%	43.80%	1.04%	40.62%	NA
Intermediate	90	28.90%	34.40%	2.22%	32.22%	GTCGTTTCGCCA: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004625809	G -> GTCGTTTCGCCA	LOC_Os10g08540.1	upstream_gene_variant ; 3483.0bp to feature; MODIFIER	silent_mutation	Average:32.864; most accessible tissue: Callus, score: 62.944	N	N	N	N
vg1004625809	G -> GTCGTTTCGCCA	LOC_Os10g08530.1	intron_variant ; MODIFIER	silent_mutation	Average:32.864; most accessible tissue: Callus, score: 62.944	N	N	N	N
vg1004625809	G -> A	LOC_Os10g08540.1	upstream_gene_variant ; 3484.0bp to feature; MODIFIER	silent_mutation	Average:32.864; most accessible tissue: Callus, score: 62.944	N	N	N	N
vg1004625809	G -> A	LOC_Os10g08530.1	intron_variant ; MODIFIER	silent_mutation	Average:32.864; most accessible tissue: Callus, score: 62.944	N	N	N	N
vg1004625809	G -> DEL	N	N	silent_mutation	Average:32.864; most accessible tissue: Callus, score: 62.944	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004625809	NA	6.02E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625809	NA	1.18E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625809	NA	5.40E-06	mr1318_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625809	2.60E-08	NA	mr1327_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625809	9.48E-07	8.32E-09	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625809	NA	3.46E-06	mr1729_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625809	NA	6.08E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004625809	NA	2.64E-06	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251