\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004623685:

Variant ID: vg1004623685 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4623685
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


AAATTCAACTCTACAAATCTCTGGAAAAAGGTGAAAGTTCACTGTTCAACTGGGCCGCCCTCCCCTTTCTTTTTTCTCGGCCCAACTCCCCTCCATCCTC[T/A]
CCTCTGTTCTTCTCCCCTTAGCAGGCCGGCCCAGCCCAGCCCGCAACTCCTCACCTTCTTCCTCCTTGAGCCAGCCTCATCCACGCACACAAGGTGTTCG

Reverse complement sequence

CGAACACCTTGTGTGCGTGGATGAGGCTGGCTCAAGGAGGAAGAAGGTGAGGAGTTGCGGGCTGGGCTGGGCCGGCCTGCTAAGGGGAGAAGAACAGAGG[A/T]
GAGGATGGAGGGGAGTTGGGCCGAGAAAAAAGAAAGGGGAGGGCGGCCCAGTTGAACAGTGAACTTTCACCTTTTTCCAGAGATTTGTAGAGTTGAATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.60% 28.70% 6.37% 33.35% NA
All Indica  2759 42.00% 2.50% 6.13% 49.44% NA
All Japonica  1512 18.80% 79.40% 0.26% 1.52% NA
Aus  269 4.50% 3.00% 37.55% 55.02% NA
Indica I  595 41.00% 2.00% 2.18% 54.79% NA
Indica II  465 37.80% 2.20% 1.94% 58.06% NA
Indica III  913 49.30% 1.50% 10.73% 38.44% NA
Indica Intermediate  786 36.60% 4.10% 6.23% 53.05% NA
Temperate Japonica  767 6.10% 93.20% 0.00% 0.65% NA
Tropical Japonica  504 32.70% 65.30% 0.00% 1.98% NA
Japonica Intermediate  241 30.30% 64.70% 1.66% 3.32% NA
VI/Aromatic  96 14.60% 43.80% 23.96% 17.71% NA
Intermediate  90 28.90% 40.00% 4.44% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004623685 T -> A LOC_Os10g08520.1 upstream_gene_variant ; 2894.0bp to feature; MODIFIER silent_mutation Average:95.527; most accessible tissue: Zhenshan97 root, score: 98.86 N N N N
vg1004623685 T -> A LOC_Os10g08530.1 upstream_gene_variant ; 1547.0bp to feature; MODIFIER silent_mutation Average:95.527; most accessible tissue: Zhenshan97 root, score: 98.86 N N N N
vg1004623685 T -> A LOC_Os10g08520-LOC_Os10g08530 intergenic_region ; MODIFIER silent_mutation Average:95.527; most accessible tissue: Zhenshan97 root, score: 98.86 N N N N
vg1004623685 T -> DEL N N silent_mutation Average:95.527; most accessible tissue: Zhenshan97 root, score: 98.86 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1004623685 T A -0.24 -0.18 -0.13 -0.17 -0.16 -0.18

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004623685 2.98E-06 NA mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623685 NA 2.70E-06 mr1020 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623685 9.79E-08 5.08E-14 mr1032 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623685 5.40E-06 2.04E-07 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623685 9.09E-07 NA mr1165 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623685 NA 1.37E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623685 1.36E-06 NA mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623685 NA 1.56E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623685 3.06E-06 NA mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623685 NA 5.05E-06 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623685 NA 7.14E-07 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623685 9.65E-06 NA mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623685 NA 2.34E-06 mr1165_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623685 2.74E-06 NA mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623685 NA 8.44E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004623685 NA 1.40E-06 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251