\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004572365:

Variant ID: vg1004572365 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4572365
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, T: 0.27, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


AAGAAATCTATCTTAATGAGCCCTTCTTACTCTGGATATAGTGTGTAAGAGTGCCTCCTTAGTTTCCGACTTTGGCCAGTCGTTTGAGTTGTACACTCTC[T/C]
CTAGCCCCCAGCCTTGCCGTTGGAGAATTCTTCTCGGGGGACAAGGCTCTTAGACCTTTGACCTGCCTCGGTTGAACAAGCACTAATCCTAGCCCCCAGC

Reverse complement sequence

GCTGGGGGCTAGGATTAGTGCTTGTTCAACCGAGGCAGGTCAAAGGTCTAAGAGCCTTGTCCCCCGAGAAGAATTCTCCAACGGCAAGGCTGGGGGCTAG[A/G]
GAGAGTGTACAACTCAAACGACTGGCCAAAGTCGGAAACTAAGGAGGCACTCTTACACACTATATCCAGAGTAAGAAGGGCTCATTAAGATAGATTTCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.50% 46.10% 0.78% 0.63% NA
All Indica  2759 52.00% 46.00% 1.05% 1.01% NA
All Japonica  1512 44.00% 55.90% 0.13% 0.00% NA
Aus  269 95.50% 3.70% 0.74% 0.00% NA
Indica I  595 58.70% 40.20% 1.18% 0.00% NA
Indica II  465 38.30% 55.70% 1.29% 4.73% NA
Indica III  913 49.10% 49.90% 0.77% 0.22% NA
Indica Intermediate  786 58.40% 39.90% 1.15% 0.51% NA
Temperate Japonica  767 22.90% 76.80% 0.26% 0.00% NA
Tropical Japonica  504 82.70% 17.30% 0.00% 0.00% NA
Japonica Intermediate  241 29.90% 70.10% 0.00% 0.00% NA
VI/Aromatic  96 83.30% 15.60% 1.04% 0.00% NA
Intermediate  90 51.10% 43.30% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004572365 T -> C LOC_Os10g08410.1 downstream_gene_variant ; 1499.0bp to feature; MODIFIER silent_mutation Average:53.12; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N
vg1004572365 T -> C LOC_Os10g08420.1 downstream_gene_variant ; 424.0bp to feature; MODIFIER silent_mutation Average:53.12; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N
vg1004572365 T -> C LOC_Os10g08410-LOC_Os10g08420 intergenic_region ; MODIFIER silent_mutation Average:53.12; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N
vg1004572365 T -> DEL N N silent_mutation Average:53.12; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004572365 NA 1.00E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572365 1.46E-06 NA mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572365 4.77E-06 4.77E-06 mr1853 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572365 3.56E-06 NA mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572365 7.98E-06 7.96E-06 mr1207_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572365 NA 2.38E-06 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572365 5.32E-06 4.25E-06 mr1318_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572365 NA 1.27E-07 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572365 NA 4.58E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572365 NA 4.34E-06 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572365 NA 9.52E-08 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572365 NA 4.24E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572365 NA 3.57E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572365 NA 2.13E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572365 7.81E-06 NA mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572365 6.27E-07 5.18E-12 mr1853_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572365 NA 1.06E-06 mr1888_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572365 1.37E-06 NA mr1897_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572365 NA 6.92E-14 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251