\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004572201:

Variant ID: vg1004572201 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4572201
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTGGCGAAGTCGATGGCACCGCTGACGGAAAAAGTTTTCCAGTCGATGGACTAGCGTTGGCCTTCCTGGTAGCCTTTGCACCCTGCGATAGACATCTT[G/A]
GGGAAAAGTGTAATATGGTTTTGGACTTGTGTGAAATTGTAAGAAGTATCTTATGAAATAGAAAAGAAATCTATCTTAATGAGCCCTTCTTACTCTGGAT

Reverse complement sequence

ATCCAGAGTAAGAAGGGCTCATTAAGATAGATTTCTTTTCTATTTCATAAGATACTTCTTACAATTTCACACAAGTCCAAAACCATATTACACTTTTCCC[C/T]
AAGATGTCTATCGCAGGGTGCAAAGGCTACCAGGAAGGCCAACGCTAGTCCATCGACTGGAAAACTTTTTCCGTCAGCGGTGCCATCGACTTCGCCAGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.80% 9.70% 0.17% 1.27% NA
All Indica  2759 96.70% 0.90% 0.22% 2.17% NA
All Japonica  1512 73.80% 26.10% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 88.20% 1.30% 0.43% 10.11% NA
Indica III  913 99.10% 0.50% 0.11% 0.22% NA
Indica Intermediate  786 96.40% 1.80% 0.38% 1.40% NA
Temperate Japonica  767 94.70% 5.20% 0.13% 0.00% NA
Tropical Japonica  504 40.10% 59.90% 0.00% 0.00% NA
Japonica Intermediate  241 78.00% 22.00% 0.00% 0.00% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004572201 G -> A LOC_Os10g08410.1 downstream_gene_variant ; 1335.0bp to feature; MODIFIER silent_mutation Average:58.82; most accessible tissue: Zhenshan97 flag leaf, score: 78.512 N N N N
vg1004572201 G -> A LOC_Os10g08420.1 downstream_gene_variant ; 588.0bp to feature; MODIFIER silent_mutation Average:58.82; most accessible tissue: Zhenshan97 flag leaf, score: 78.512 N N N N
vg1004572201 G -> A LOC_Os10g08410-LOC_Os10g08420 intergenic_region ; MODIFIER silent_mutation Average:58.82; most accessible tissue: Zhenshan97 flag leaf, score: 78.512 N N N N
vg1004572201 G -> DEL N N silent_mutation Average:58.82; most accessible tissue: Zhenshan97 flag leaf, score: 78.512 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004572201 9.89E-07 NA mr1020 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 1.77E-07 NA mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 NA 9.02E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 4.62E-06 NA mr1032 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 9.94E-06 NA mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 NA 7.46E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 NA 6.22E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 NA 1.06E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 NA 8.60E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 NA 4.32E-08 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 5.48E-08 NA mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 NA 5.33E-12 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 NA 6.74E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 NA 6.92E-11 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 NA 9.41E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 NA 4.64E-06 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 NA 2.45E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 NA 6.06E-08 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 NA 6.06E-08 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 1.89E-06 NA mr1971 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 NA 2.88E-09 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 NA 4.42E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 NA 7.20E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004572201 NA 4.20E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251