\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004568048:

Variant ID: vg1004568048 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4568048
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GCAATCGCAGTACCACGTCTCCTCTGGTTATCAACCGTGCCGAAATCCGGTTGACCTCGCCGAGAAGGCTAATCCCTGCATGCGAATCGAAGAACACAAG[C/T]
AAGAACAAGATATATTGCAACCAAATTGCATATGAACGATTAAGCACACAAATTTGGGGTTCTACAAACCGATCTAGCGGCGAAACTGTTCTTGACAGAA

Reverse complement sequence

TTCTGTCAAGAACAGTTTCGCCGCTAGATCGGTTTGTAGAACCCCAAATTTGTGTGCTTAATCGTTCATATGCAATTTGGTTGCAATATATCTTGTTCTT[G/A]
CTTGTGTTCTTCGATTCGCATGCAGGGATTAGCCTTCTCGGCGAGGTCAACCGGATTTCGGCACGGTTGATAACCAGAGGAGACGTGGTACTGCGATTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.50% 29.10% 2.20% 31.13% NA
All Indica  2759 21.60% 33.20% 3.33% 41.83% NA
All Japonica  1512 54.10% 27.10% 0.66% 18.19% NA
Aus  269 96.30% 0.00% 0.00% 3.72% NA
Indica I  595 43.20% 18.20% 0.00% 38.66% NA
Indica II  465 13.50% 28.80% 12.04% 45.59% NA
Indica III  913 12.90% 36.90% 2.08% 48.08% NA
Indica Intermediate  786 20.10% 43.00% 2.16% 34.73% NA
Temperate Japonica  767 87.90% 5.90% 0.91% 5.35% NA
Tropical Japonica  504 6.70% 60.70% 0.40% 32.14% NA
Japonica Intermediate  241 45.60% 24.10% 0.41% 29.88% NA
VI/Aromatic  96 58.30% 28.10% 0.00% 13.54% NA
Intermediate  90 50.00% 26.70% 2.22% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004568048 C -> T LOC_Os10g08400.1 upstream_gene_variant ; 4049.0bp to feature; MODIFIER silent_mutation Average:25.585; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 N N N N
vg1004568048 C -> T LOC_Os10g08410.1 upstream_gene_variant ; 1094.0bp to feature; MODIFIER silent_mutation Average:25.585; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 N N N N
vg1004568048 C -> T LOC_Os10g08420.1 downstream_gene_variant ; 4741.0bp to feature; MODIFIER silent_mutation Average:25.585; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 N N N N
vg1004568048 C -> T LOC_Os10g08400-LOC_Os10g08410 intergenic_region ; MODIFIER silent_mutation Average:25.585; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 N N N N
vg1004568048 C -> DEL N N silent_mutation Average:25.585; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004568048 6.04E-06 NA mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 6.18E-07 NA mr1032 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 8.66E-06 1.62E-09 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 1.94E-06 NA mr1478 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 NA 1.04E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 NA 6.62E-06 mr1725 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 NA 5.65E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 NA 2.96E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 NA 3.94E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 NA 8.82E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 NA 1.79E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 NA 7.97E-06 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 NA 1.18E-07 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 NA 2.50E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 NA 3.36E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 NA 7.49E-08 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 NA 1.39E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 NA 3.26E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 NA 1.67E-07 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 NA 6.51E-06 mr1707_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004568048 NA 1.95E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251