\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004563375:

Variant ID: vg1004563375 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4563375
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ATAACTCAAATTAATCTAAAAAGAATTCATTTGTGCGATAAATAAATAAATATGGGTAATAATTTTGGATAAATTTTGATGAGTATTCAGTGCTTAAGTT[T/G]
AGTTAACATTTAACTAAGTAAATTTAGAGTTTATAGGATTAAAATTGTATCGGAGATAGGCTAAATAGGGGTTTAATTAAGGATAGCACTATTCATTGCA

Reverse complement sequence

TGCAATGAATAGTGCTATCCTTAATTAAACCCCTATTTAGCCTATCTCCGATACAATTTTAATCCTATAAACTCTAAATTTACTTAGTTAAATGTTAACT[A/C]
AACTTAAGCACTGAATACTCATCAAAATTTATCCAAAATTATTACCCATATTTATTTATTTATCGCACAAATGAATTCTTTTTAGATTAATTTGAGTTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.00% 28.60% 0.72% 17.71% NA
All Indica  2759 51.90% 32.60% 0.72% 14.75% NA
All Japonica  1512 62.90% 26.70% 0.60% 9.79% NA
Aus  269 6.70% 0.00% 0.74% 92.57% NA
Indica I  595 41.70% 18.70% 0.34% 39.33% NA
Indica II  465 62.60% 27.70% 0.65% 9.03% NA
Indica III  913 59.40% 36.00% 0.66% 3.94% NA
Indica Intermediate  786 44.80% 42.00% 1.15% 12.09% NA
Temperate Japonica  767 93.60% 5.50% 0.26% 0.65% NA
Tropical Japonica  504 16.30% 60.30% 0.60% 22.82% NA
Japonica Intermediate  241 62.70% 24.10% 1.66% 11.62% NA
VI/Aromatic  96 53.10% 28.10% 0.00% 18.75% NA
Intermediate  90 56.70% 23.30% 3.33% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004563375 T -> G LOC_Os10g08400.1 intron_variant ; MODIFIER silent_mutation Average:31.829; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg1004563375 T -> DEL N N silent_mutation Average:31.829; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004563375 NA 1.63E-08 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004563375 NA 2.29E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004563375 NA 9.80E-09 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004563375 NA 2.50E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004563375 NA 3.56E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004563375 NA 3.79E-06 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004563375 NA 9.13E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004563375 NA 6.25E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004563375 NA 1.45E-07 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004563375 NA 4.51E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004563375 NA 1.07E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004563375 NA 1.65E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004563375 NA 5.13E-06 mr1707_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004563375 NA 5.87E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004563375 NA 4.06E-06 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004563375 7.84E-06 NA mr1887_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004563375 NA 1.82E-06 mr1887_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004563375 NA 1.20E-09 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251