\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004557367:

Variant ID: vg1004557367 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4557367
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTCCTACAACAACAGTTACCAGGCTAGTCTGCTAATGGCACCATTTGAAGCACTGCATGGACGGAGGTGTCGCACTCTGCTCTTCTGGGATCAGACAG[G/A]
GCAACGCCAGTTGTTTGGTACAGAAGTTTTAAATGAGGCAGAAGAGAAAGTCAGAGCTGCCAGGGAAAGATTAAGAATAGCGCAATCTCGACAGAAAAGC

Reverse complement sequence

GCTTTTCTGTCGAGATTGCGCTATTCTTAATCTTTCCCTGGCAGCTCTGACTTTCTCTTCTGCCTCATTTAAAACTTCTGTACCAAACAACTGGCGTTGC[C/T]
CTGTCTGATCCCAGAAGAGCAGAGTGCGACACCTCCGTCCATGCAGTGCTTCAAATGGTGCCATTAGCAGACTAGCCTGGTAACTGTTGTTGTAGGAGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.40% 9.40% 1.14% 7.09% NA
All Indica  2759 91.30% 0.70% 1.20% 6.81% NA
All Japonica  1512 73.10% 25.30% 0.26% 1.32% NA
Aus  269 51.70% 0.00% 5.95% 42.38% NA
Indica I  595 76.00% 0.20% 2.52% 21.34% NA
Indica II  465 95.10% 0.20% 1.29% 3.44% NA
Indica III  913 98.10% 0.40% 0.44% 0.99% NA
Indica Intermediate  786 92.90% 1.50% 1.02% 4.58% NA
Temperate Japonica  767 94.90% 5.00% 0.13% 0.00% NA
Tropical Japonica  504 37.70% 57.90% 0.60% 3.77% NA
Japonica Intermediate  241 77.60% 22.00% 0.00% 0.41% NA
VI/Aromatic  96 63.50% 28.10% 0.00% 8.33% NA
Intermediate  90 77.80% 15.60% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004557367 G -> A LOC_Os10g08390.1 missense_variant ; p.Gly716Glu; MODERATE nonsynonymous_codon ; G716E Average:32.657; most accessible tissue: Minghui63 flag leaf, score: 59.244 benign 1.149 DELETERIOUS 0.01
vg1004557367 G -> DEL LOC_Os10g08390.1 N frameshift_variant Average:32.657; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004557367 NA 7.41E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 NA 3.20E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 NA 2.85E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 1.62E-06 4.67E-10 mr1471 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 7.30E-07 NA mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 NA 1.20E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 NA 8.33E-06 mr1553 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 NA 5.06E-11 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 NA 8.95E-08 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 NA 2.84E-06 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 NA 6.72E-06 mr1725 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 NA 9.14E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 NA 1.82E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 NA 1.82E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 NA 1.30E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 NA 6.72E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 NA 4.24E-11 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 NA 9.54E-06 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 NA 1.31E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 NA 3.19E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 NA 1.78E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004557367 NA 7.93E-07 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251