Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004515571:

Variant ID: vg1004515571 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4515571
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

GGCGACGGGAGCAGGGGCGAGCCGGCGGCGCGAGCAGGGATGAAACGGTGGCGGGAGCGCATGAGCAAGGGCGAGCTGACGGTGCAAACAGGGGCAAGGC[G/A]
GCGGTGGGAGCGCATGAGCAGGGAGCTGGTGATGCCTCTTCTCTTGCCGGTCGCTACTCTGCTATCCTTCTGTAAATTTCTCTATCCAATAATTGGTATT

Reverse complement sequence

AATACCAATTATTGGATAGAGAAATTTACAGAAGGATAGCAGAGTAGCGACCGGCAAGAGAAGAGGCATCACCAGCTCCCTGCTCATGCGCTCCCACCGC[C/T]
GCCTTGCCCCTGTTTGCACCGTCAGCTCGCCCTTGCTCATGCGCTCCCGCCACCGTTTCATCCCTGCTCGCGCCGCCGGCTCGCCCCTGCTCCCGTCGCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.60%	9.00%	0.00%	2.41%	NA
All Indica	2759	94.00%	5.70%	0.00%	0.29%	NA
All Japonica	1512	77.50%	15.70%	0.00%	6.81%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	88.20%	11.80%	0.00%	0.00%	NA
Indica III	913	91.10%	8.00%	0.00%	0.88%	NA
Indica Intermediate	786	96.60%	3.40%	0.00%	0.00%	NA
Temperate Japonica	767	86.30%	13.70%	0.00%	0.00%	NA
Tropical Japonica	504	67.50%	12.50%	0.00%	20.04%	NA
Japonica Intermediate	241	70.50%	28.60%	0.00%	0.83%	NA
VI/Aromatic	96	71.90%	28.10%	0.00%	0.00%	NA
Intermediate	90	93.30%	3.30%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004515571	G -> A	LOC_Os10g08340.1	upstream_gene_variant ; 217.0bp to feature; MODIFIER	silent_mutation	Average:53.046; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N
vg1004515571	G -> A	LOC_Os10g08340-LOC_Os10g08350	intergenic_region ; MODIFIER	silent_mutation	Average:53.046; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N
vg1004515571	G -> DEL	N	N	silent_mutation	Average:53.046; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004515571	NA	1.69E-14	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	7.28E-13	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	8.28E-13	mr1022	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	1.32E-10	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	1.19E-13	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	9.57E-14	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	3.96E-06	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	5.85E-12	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	1.40E-12	mr1142	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	2.88E-13	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	2.65E-14	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	3.60E-08	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	7.03E-14	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	3.68E-12	mr1491	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	4.99E-10	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	1.55E-06	mr1708	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	1.47E-16	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	1.11E-12	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	4.16E-17	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	3.30E-16	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	5.46E-14	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	4.87E-16	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	1.14E-15	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	7.41E-07	NA	mr1403_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	7.24E-06	mr1403_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	9.21E-15	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004515571	NA	2.74E-06	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251