\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004482065:

Variant ID: vg1004482065 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4482065
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.30, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTAGAGATAAATCTACTCTTGTATTGTACTCCAAGTTTCTATCCCCTATATACTCCTATATATACCCTATGAGAGGGTCGATCTAATAGACGAGAAAA[C/T]
AACATAATACAACTACATAACATAAGTATGAAAATACTTTGGACCAAACGTCCGACGGGAGACAATTCATCGGATGCTACACCCACCGAGCCCACTTCAC

Reverse complement sequence

GTGAAGTGGGCTCGGTGGGTGTAGCATCCGATGAATTGTCTCCCGTCGGACGTTTGGTCCAAAGTATTTTCATACTTATGTTATGTAGTTGTATTATGTT[G/A]
TTTTCTCGTCTATTAGATCGACCCTCTCATAGGGTATATATAGGAGTATATAGGGGATAGAAACTTGGAGTACAATACAAGAGTAGATTTATCTCTAGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.80% 49.70% 0.17% 0.34% NA
All Indica  2759 46.70% 52.60% 0.22% 0.51% NA
All Japonica  1512 64.90% 35.10% 0.07% 0.00% NA
Aus  269 5.20% 94.80% 0.00% 0.00% NA
Indica I  595 41.20% 58.50% 0.17% 0.17% NA
Indica II  465 60.20% 38.70% 0.22% 0.86% NA
Indica III  913 48.80% 50.50% 0.11% 0.55% NA
Indica Intermediate  786 40.50% 58.70% 0.38% 0.51% NA
Temperate Japonica  767 94.00% 6.00% 0.00% 0.00% NA
Tropical Japonica  504 17.50% 82.50% 0.00% 0.00% NA
Japonica Intermediate  241 71.40% 28.20% 0.41% 0.00% NA
VI/Aromatic  96 29.20% 70.80% 0.00% 0.00% NA
Intermediate  90 47.80% 48.90% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004482065 C -> T LOC_Os10g08300.1 upstream_gene_variant ; 2211.0bp to feature; MODIFIER silent_mutation Average:56.614; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg1004482065 C -> T LOC_Os10g08280.1 downstream_gene_variant ; 2177.0bp to feature; MODIFIER silent_mutation Average:56.614; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg1004482065 C -> T LOC_Os10g08290.1 downstream_gene_variant ; 660.0bp to feature; MODIFIER silent_mutation Average:56.614; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg1004482065 C -> T LOC_Os10g08290-LOC_Os10g08300 intergenic_region ; MODIFIER silent_mutation Average:56.614; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg1004482065 C -> DEL N N silent_mutation Average:56.614; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004482065 NA 4.55E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1004482065 NA 2.30E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 6.51E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 9.42E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 5.10E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 8.39E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 8.05E-06 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 8.67E-07 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 8.03E-07 2.98E-13 mr1853 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 2.45E-06 2.45E-06 mr1853 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 1.77E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 3.97E-09 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 4.17E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 4.61E-10 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 1.70E-06 NA mr1053_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 2.47E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 2.94E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 8.78E-06 NA mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 2.18E-06 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 9.97E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 4.71E-08 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 5.96E-09 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 1.02E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 2.48E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 6.52E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 3.52E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 8.95E-08 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 1.66E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 7.38E-07 1.48E-13 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 3.19E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004482065 NA 1.64E-15 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251