\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004372976:

Variant ID: vg1004372976 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4372976
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAGGGCAGATTTAATGTATCATTGAAGCATATAGAGCAAATATAATTAAATCAGGTAAGATCGGCTGAAACTCCGATACTATTCTAATCGGCAACCAG[G/A,T]
AGGCAGGCTAGAGATTGATATTCTAAGCACGACTTAATAGATCAAACTCAACTGATGCAGCACTAAGTATGAAAAGAAGAACAATATCTAGACAATCAAG

Reverse complement sequence

CTTGATTGTCTAGATATTGTTCTTCTTTTCATACTTAGTGCTGCATCAGTTGAGTTTGATCTATTAAGTCGTGCTTAGAATATCAATCTCTAGCCTGCCT[C/T,A]
CTGGTTGCCGATTAGAATAGTATCGGAGTTTCAGCCGATCTTACCTGATTTAATTATATTTGCTCTATATGCTTCAATGATACATTAAATCTGCCCTTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.80% 2.90% 20.52% 28.76% T: 0.02%
All Indica  2759 40.60% 4.60% 29.72% 25.12% NA
All Japonica  1512 52.70% 0.50% 8.00% 38.82% NA
Aus  269 94.80% 0.00% 2.97% 1.86% T: 0.37%
Indica I  595 76.00% 0.50% 13.11% 10.42% NA
Indica II  465 35.50% 0.40% 41.72% 22.37% NA
Indica III  913 17.00% 11.90% 32.86% 38.23% NA
Indica Intermediate  786 44.10% 1.70% 31.55% 22.65% NA
Temperate Japonica  767 76.80% 0.10% 7.82% 15.25% NA
Tropical Japonica  504 20.60% 0.80% 8.93% 69.64% NA
Japonica Intermediate  241 43.20% 0.80% 6.64% 49.38% NA
VI/Aromatic  96 37.50% 0.00% 8.33% 54.17% NA
Intermediate  90 57.80% 3.30% 14.44% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004372976 G -> T LOC_Os10g08080.1 upstream_gene_variant ; 1132.0bp to feature; MODIFIER silent_mutation Average:15.673; most accessible tissue: Callus, score: 34.561 N N N N
vg1004372976 G -> T LOC_Os10g08060.1 downstream_gene_variant ; 2118.0bp to feature; MODIFIER silent_mutation Average:15.673; most accessible tissue: Callus, score: 34.561 N N N N
vg1004372976 G -> T LOC_Os10g08070.1 downstream_gene_variant ; 771.0bp to feature; MODIFIER silent_mutation Average:15.673; most accessible tissue: Callus, score: 34.561 N N N N
vg1004372976 G -> T LOC_Os10g08070-LOC_Os10g08080 intergenic_region ; MODIFIER silent_mutation Average:15.673; most accessible tissue: Callus, score: 34.561 N N N N
vg1004372976 G -> A LOC_Os10g08080.1 upstream_gene_variant ; 1132.0bp to feature; MODIFIER silent_mutation Average:15.673; most accessible tissue: Callus, score: 34.561 N N N N
vg1004372976 G -> A LOC_Os10g08060.1 downstream_gene_variant ; 2118.0bp to feature; MODIFIER silent_mutation Average:15.673; most accessible tissue: Callus, score: 34.561 N N N N
vg1004372976 G -> A LOC_Os10g08070.1 downstream_gene_variant ; 771.0bp to feature; MODIFIER silent_mutation Average:15.673; most accessible tissue: Callus, score: 34.561 N N N N
vg1004372976 G -> A LOC_Os10g08070-LOC_Os10g08080 intergenic_region ; MODIFIER silent_mutation Average:15.673; most accessible tissue: Callus, score: 34.561 N N N N
vg1004372976 G -> DEL N N silent_mutation Average:15.673; most accessible tissue: Callus, score: 34.561 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004372976 3.25E-06 NA mr1950 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251