Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1004372976:

Variant ID: vg1004372976 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4372976
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

TAAAGGGCAGATTTAATGTATCATTGAAGCATATAGAGCAAATATAATTAAATCAGGTAAGATCGGCTGAAACTCCGATACTATTCTAATCGGCAACCAG[G/A,T]
AGGCAGGCTAGAGATTGATATTCTAAGCACGACTTAATAGATCAAACTCAACTGATGCAGCACTAAGTATGAAAAGAAGAACAATATCTAGACAATCAAG

Reverse complement sequence

CTTGATTGTCTAGATATTGTTCTTCTTTTCATACTTAGTGCTGCATCAGTTGAGTTTGATCTATTAAGTCGTGCTTAGAATATCAATCTCTAGCCTGCCT[C/T,A]
CTGGTTGCCGATTAGAATAGTATCGGAGTTTCAGCCGATCTTACCTGATTTAATTATATTTGCTCTATATGCTTCAATGATACATTAAATCTGCCCTTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.80%	2.90%	20.52%	28.76%	T: 0.02%
All Indica	2759	40.60%	4.60%	29.72%	25.12%	NA
All Japonica	1512	52.70%	0.50%	8.00%	38.82%	NA
Aus	269	94.80%	0.00%	2.97%	1.86%	T: 0.37%
Indica I	595	76.00%	0.50%	13.11%	10.42%	NA
Indica II	465	35.50%	0.40%	41.72%	22.37%	NA
Indica III	913	17.00%	11.90%	32.86%	38.23%	NA
Indica Intermediate	786	44.10%	1.70%	31.55%	22.65%	NA
Temperate Japonica	767	76.80%	0.10%	7.82%	15.25%	NA
Tropical Japonica	504	20.60%	0.80%	8.93%	69.64%	NA
Japonica Intermediate	241	43.20%	0.80%	6.64%	49.38%	NA
VI/Aromatic	96	37.50%	0.00%	8.33%	54.17%	NA
Intermediate	90	57.80%	3.30%	14.44%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004372976	G -> T	LOC_Os10g08080.1	upstream_gene_variant ; 1132.0bp to feature; MODIFIER	silent_mutation	Average:15.673; most accessible tissue: Callus, score: 34.561	N	N	N	N
vg1004372976	G -> T	LOC_Os10g08060.1	downstream_gene_variant ; 2118.0bp to feature; MODIFIER	silent_mutation	Average:15.673; most accessible tissue: Callus, score: 34.561	N	N	N	N
vg1004372976	G -> T	LOC_Os10g08070.1	downstream_gene_variant ; 771.0bp to feature; MODIFIER	silent_mutation	Average:15.673; most accessible tissue: Callus, score: 34.561	N	N	N	N
vg1004372976	G -> T	LOC_Os10g08070-LOC_Os10g08080	intergenic_region ; MODIFIER	silent_mutation	Average:15.673; most accessible tissue: Callus, score: 34.561	N	N	N	N
vg1004372976	G -> A	LOC_Os10g08080.1	upstream_gene_variant ; 1132.0bp to feature; MODIFIER	silent_mutation	Average:15.673; most accessible tissue: Callus, score: 34.561	N	N	N	N
vg1004372976	G -> A	LOC_Os10g08060.1	downstream_gene_variant ; 2118.0bp to feature; MODIFIER	silent_mutation	Average:15.673; most accessible tissue: Callus, score: 34.561	N	N	N	N
vg1004372976	G -> A	LOC_Os10g08070.1	downstream_gene_variant ; 771.0bp to feature; MODIFIER	silent_mutation	Average:15.673; most accessible tissue: Callus, score: 34.561	N	N	N	N
vg1004372976	G -> A	LOC_Os10g08070-LOC_Os10g08080	intergenic_region ; MODIFIER	silent_mutation	Average:15.673; most accessible tissue: Callus, score: 34.561	N	N	N	N
vg1004372976	G -> DEL	N	N	silent_mutation	Average:15.673; most accessible tissue: Callus, score: 34.561	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004372976	3.25E-06	NA	mr1950	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251