\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004361310:

Variant ID: vg1004361310 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4361310
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGATGGCTCCAAAAACATACCAACCTGACATACAACAACATGCTACTAGCTTTATTTTTTAATCGTGCTATTCTCTTGTTCCAACGCTGCATGTTGCTC[T/C]
CCTATTTTTCTACTAGCTGTTGTGAGGGGTGGAGTTACAGGCAATCATCGGGGTGATGTTTTTTGCCGATGTCTAGTACCCCTCTTATTTTACAAGCTAT

Reverse complement sequence

ATAGCTTGTAAAATAAGAGGGGTACTAGACATCGGCAAAAAACATCACCCCGATGATTGCCTGTAACTCCACCCCTCACAACAGCTAGTAGAAAAATAGG[A/G]
GAGCAACATGCAGCGTTGGAACAAGAGAATAGCACGATTAAAAAATAAAGCTAGTAGCATGTTGTTGTATGTCAGGTTGGTATGTTTTTGGAGCCATCAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 4.00% 2.35% 42.53% NA
All Indica  2759 41.60% 4.00% 1.27% 53.14% NA
All Japonica  1512 59.20% 4.80% 4.89% 31.15% NA
Aus  269 94.40% 0.00% 0.00% 5.58% NA
Indica I  595 75.30% 0.30% 3.19% 21.18% NA
Indica II  465 44.50% 1.10% 1.08% 53.33% NA
Indica III  913 15.40% 9.00% 0.11% 75.47% NA
Indica Intermediate  786 44.70% 2.80% 1.27% 51.27% NA
Temperate Japonica  767 75.20% 7.30% 6.78% 10.69% NA
Tropical Japonica  504 33.10% 0.00% 2.78% 64.09% NA
Japonica Intermediate  241 62.70% 6.60% 3.32% 27.39% NA
VI/Aromatic  96 70.80% 1.00% 0.00% 28.12% NA
Intermediate  90 57.80% 5.60% 2.22% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004361310 T -> C LOC_Os10g08040.1 upstream_gene_variant ; 2141.0bp to feature; MODIFIER silent_mutation Average:47.451; most accessible tissue: Callus, score: 90.401 N N N N
vg1004361310 T -> C LOC_Os10g08040-LOC_Os10g08050 intergenic_region ; MODIFIER silent_mutation Average:47.451; most accessible tissue: Callus, score: 90.401 N N N N
vg1004361310 T -> DEL N N silent_mutation Average:47.451; most accessible tissue: Callus, score: 90.401 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004361310 NA 9.86E-10 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004361310 NA 2.74E-08 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004361310 NA 5.25E-07 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004361310 NA 1.35E-10 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004361310 NA 2.09E-08 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004361310 NA 4.05E-07 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004361310 8.06E-06 4.96E-11 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004361310 NA 1.21E-07 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004361310 NA 6.05E-08 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004361310 2.15E-07 1.00E-13 mr1913_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004361310 NA 4.58E-07 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251