\
| Variant ID: vg1004361310 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4361310 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTGATGGCTCCAAAAACATACCAACCTGACATACAACAACATGCTACTAGCTTTATTTTTTAATCGTGCTATTCTCTTGTTCCAACGCTGCATGTTGCTC[T/C]
CCTATTTTTCTACTAGCTGTTGTGAGGGGTGGAGTTACAGGCAATCATCGGGGTGATGTTTTTTGCCGATGTCTAGTACCCCTCTTATTTTACAAGCTAT
ATAGCTTGTAAAATAAGAGGGGTACTAGACATCGGCAAAAAACATCACCCCGATGATTGCCTGTAACTCCACCCCTCACAACAGCTAGTAGAAAAATAGG[A/G]
GAGCAACATGCAGCGTTGGAACAAGAGAATAGCACGATTAAAAAATAAAGCTAGTAGCATGTTGTTGTATGTCAGGTTGGTATGTTTTTGGAGCCATCAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.10% | 4.00% | 2.35% | 42.53% | NA |
| All Indica | 2759 | 41.60% | 4.00% | 1.27% | 53.14% | NA |
| All Japonica | 1512 | 59.20% | 4.80% | 4.89% | 31.15% | NA |
| Aus | 269 | 94.40% | 0.00% | 0.00% | 5.58% | NA |
| Indica I | 595 | 75.30% | 0.30% | 3.19% | 21.18% | NA |
| Indica II | 465 | 44.50% | 1.10% | 1.08% | 53.33% | NA |
| Indica III | 913 | 15.40% | 9.00% | 0.11% | 75.47% | NA |
| Indica Intermediate | 786 | 44.70% | 2.80% | 1.27% | 51.27% | NA |
| Temperate Japonica | 767 | 75.20% | 7.30% | 6.78% | 10.69% | NA |
| Tropical Japonica | 504 | 33.10% | 0.00% | 2.78% | 64.09% | NA |
| Japonica Intermediate | 241 | 62.70% | 6.60% | 3.32% | 27.39% | NA |
| VI/Aromatic | 96 | 70.80% | 1.00% | 0.00% | 28.12% | NA |
| Intermediate | 90 | 57.80% | 5.60% | 2.22% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004361310 | T -> C | LOC_Os10g08040.1 | upstream_gene_variant ; 2141.0bp to feature; MODIFIER | silent_mutation | Average:47.451; most accessible tissue: Callus, score: 90.401 | N | N | N | N |
| vg1004361310 | T -> C | LOC_Os10g08040-LOC_Os10g08050 | intergenic_region ; MODIFIER | silent_mutation | Average:47.451; most accessible tissue: Callus, score: 90.401 | N | N | N | N |
| vg1004361310 | T -> DEL | N | N | silent_mutation | Average:47.451; most accessible tissue: Callus, score: 90.401 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004361310 | NA | 9.86E-10 | mr1913 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004361310 | NA | 2.74E-08 | mr1071_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004361310 | NA | 5.25E-07 | mr1080_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004361310 | NA | 1.35E-10 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004361310 | NA | 2.09E-08 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004361310 | NA | 4.05E-07 | mr1402_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004361310 | 8.06E-06 | 4.96E-11 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004361310 | NA | 1.21E-07 | mr1619_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004361310 | NA | 6.05E-08 | mr1795_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004361310 | 2.15E-07 | 1.00E-13 | mr1913_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004361310 | NA | 4.58E-07 | mr1962_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |