\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004272649:

Variant ID: vg1004272649 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4272649
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GGCAAGTTTTTTTTTCTGTTCCTATGATGAACTGTTTATTCTTCTGTGGTGAACTATTTATCCCGTGACTCATGTCCTATTTTTGCAAAATAGCTAAATA[G/A]
CTTAGCTGCAGCAATAGCCCGCTATATCTGATCGTATCTAAAAATTGGAGCCCGAGATTTGAATCATTGGTACATATTGACTATGGTGCCTATTATAGAT

Reverse complement sequence

ATCTATAATAGGCACCATAGTCAATATGTACCAATGATTCAAATCTCGGGCTCCAATTTTTAGATACGATCAGATATAGCGGGCTATTGCTGCAGCTAAG[C/T]
TATTTAGCTATTTTGCAAAAATAGGACATGAGTCACGGGATAAATAGTTCACCACAGAAGAATAAACAGTTCATCATAGGAACAGAAAAAAAAACTTGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 8.80% 0.08% 0.00% NA
All Indica  2759 94.60% 5.40% 0.07% 0.00% NA
All Japonica  1512 86.00% 13.90% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 95.30% 4.50% 0.22% 0.00% NA
Indica III  913 92.60% 7.40% 0.00% 0.00% NA
Indica Intermediate  786 93.50% 6.40% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 66.70% 33.30% 0.00% 0.00% NA
Japonica Intermediate  241 83.00% 16.60% 0.41% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 84.40% 14.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004272649 G -> A LOC_Os10g07986.1 upstream_gene_variant ; 3217.0bp to feature; MODIFIER silent_mutation Average:60.152; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg1004272649 G -> A LOC_Os10g07982.1 downstream_gene_variant ; 248.0bp to feature; MODIFIER silent_mutation Average:60.152; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg1004272649 G -> A LOC_Os10g07978-LOC_Os10g07982 intergenic_region ; MODIFIER silent_mutation Average:60.152; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004272649 NA 8.81E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004272649 NA 8.64E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004272649 NA 4.31E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004272649 NA 1.74E-09 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004272649 3.42E-06 NA mr1403_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004272649 NA 2.03E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251