Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004262572:

Variant ID: vg1004262572 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4262572
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGAAATCTCCTCCTCTTTGCGAGTAAAAAAACCCTCGGCTACGGGCTATCCACAAACTGCCATCGACGGATACTGTGTGGGTCGCCCATGGCGATTGGC[C/G]
ACAGCCGCTGCCGCGGCGTGGGTTTTCCGGTCGCAAAGAAACCGTCAAACGCCGCGGCCGCACCAAGCCACCCACTCGCCGCGGCCACTCGATATCCTCG

Reverse complement sequence

CGAGGATATCGAGTGGCCGCGGCGAGTGGGTGGCTTGGTGCGGCCGCGGCGTTTGACGGTTTCTTTGCGACCGGAAAACCCACGCCGCGGCAGCGGCTGT[G/C]
GCCAATCGCCATGGGCGACCCACACAGTATCCGTCGATGGCAGTTTGTGGATAGCCCGTAGCCGAGGGTTTTTTTACTCGCAAAGAGGAGGAGATTTCGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.00% 17.00% 0.00% 0.00% NA
All Indica  2759 99.10% 0.90% 0.00% 0.00% NA
All Japonica  1512 51.10% 48.90% 0.00% 0.00% NA
Aus  269 95.20% 4.80% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 21.40% 78.60% 0.00% 0.00% NA
Tropical Japonica  504 94.00% 6.00% 0.00% 0.00% NA
Japonica Intermediate  241 56.00% 44.00% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004262572 C -> G LOC_Os10g07978.1 5_prime_UTR_variant ; 869.0bp to feature; MODIFIER silent_mutation Average:86.216; most accessible tissue: Zhenshan97 flag leaf, score: 93.09 N N N N
vg1004262572 C -> G LOC_Os10g07978.2 5_prime_UTR_variant ; 869.0bp to feature; MODIFIER silent_mutation Average:86.216; most accessible tissue: Zhenshan97 flag leaf, score: 93.09 N N N N
vg1004262572 C -> G LOC_Os10g07974.1 upstream_gene_variant ; 2168.0bp to feature; MODIFIER silent_mutation Average:86.216; most accessible tissue: Zhenshan97 flag leaf, score: 93.09 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1004262572 C G 0.01 -0.06 -0.11 -0.12 -0.09 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004262572 NA 3.32E-22 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004262572 7.22E-06 5.09E-36 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004262572 NA 8.48E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004262572 NA 3.54E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004262572 1.65E-11 4.24E-25 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004262572 9.12E-07 2.48E-08 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004262572 NA 2.59E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004262572 NA 8.06E-11 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004262572 NA 7.94E-07 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004262572 NA 1.01E-14 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004262572 NA 1.66E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004262572 8.05E-06 6.36E-33 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004262572 NA 6.89E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004262572 NA 5.51E-08 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004262572 NA 1.87E-24 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004262572 NA 3.53E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004262572 1.02E-07 1.88E-29 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004262572 NA 2.58E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004262572 5.79E-07 1.63E-17 mr1959_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004262572 NA 5.93E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251