Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004261816:

Variant ID: vg1004261816 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4261816
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGATCGGATTCTGAGTTCCGACGGAAACTGTCCTTATCATTTTCGATCCCGTTTCCGAGAAAATATTTTCGAATTCGTTTCCGTTTCCAAAAAATTCCGA[T/C]
CGATATATTCCGTTTTTGAAAATAGGTCTGGAATTTGGAAAGTTTCTGTACTGTTTTCACCCTAGTATTAACTACATACGGCTCATTATTGCATCGCGTA

Reverse complement sequence

TACGCGATGCAATAATGAGCCGTATGTAGTTAATACTAGGGTGAAAACAGTACAGAAACTTTCCAAATTCCAGACCTATTTTCAAAAACGGAATATATCG[A/G]
TCGGAATTTTTTGGAAACGGAAACGAATTCGAAAATATTTTCTCGGAAACGGGATCGAAAATGATAAGGACAGTTTCCGTCGGAACTCAGAATCCGATCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.20%	16.80%	0.02%	0.00%	NA
All Indica	2759	99.20%	0.80%	0.00%	0.00%	NA
All Japonica	1512	51.40%	48.60%	0.00%	0.00%	NA
Aus	269	96.70%	3.30%	0.00%	0.00%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.20%	0.80%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	21.30%	78.70%	0.00%	0.00%	NA
Tropical Japonica	504	94.80%	5.20%	0.00%	0.00%	NA
Japonica Intermediate	241	56.40%	43.60%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	83.30%	15.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004261816	T -> C	LOC_Os10g07974.1	upstream_gene_variant ; 1412.0bp to feature; MODIFIER	silent_mutation	Average:52.695; most accessible tissue: Minghui63 root, score: 64.607	N	N	N	N
vg1004261816	T -> C	LOC_Os10g07978.1	upstream_gene_variant ; 699.0bp to feature; MODIFIER	silent_mutation	Average:52.695; most accessible tissue: Minghui63 root, score: 64.607	N	N	N	N
vg1004261816	T -> C	LOC_Os10g07978.2	upstream_gene_variant ; 699.0bp to feature; MODIFIER	silent_mutation	Average:52.695; most accessible tissue: Minghui63 root, score: 64.607	N	N	N	N
vg1004261816	T -> C	LOC_Os10g07974-LOC_Os10g07978	intergenic_region ; MODIFIER	silent_mutation	Average:52.695; most accessible tissue: Minghui63 root, score: 64.607	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004261816	NA	9.78E-06	Yield	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1004261816	NA	2.86E-23	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816	1.36E-07	1.14E-38	mr1310	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816	NA	1.30E-07	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816	NA	1.97E-10	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816	NA	1.91E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816	9.22E-11	3.64E-24	mr1768	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816	2.72E-06	1.37E-07	mr1768	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816	7.02E-06	1.35E-39	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816	NA	1.22E-10	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816	NA	4.42E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816	NA	8.29E-14	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816	4.23E-06	1.38E-33	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816	NA	3.67E-07	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816	NA	1.61E-07	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816	6.19E-07	1.86E-28	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816	NA	9.51E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816	4.21E-06	2.22E-16	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816	NA	5.89E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251