\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004261816:

Variant ID: vg1004261816 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4261816
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGATCGGATTCTGAGTTCCGACGGAAACTGTCCTTATCATTTTCGATCCCGTTTCCGAGAAAATATTTTCGAATTCGTTTCCGTTTCCAAAAAATTCCGA[T/C]
CGATATATTCCGTTTTTGAAAATAGGTCTGGAATTTGGAAAGTTTCTGTACTGTTTTCACCCTAGTATTAACTACATACGGCTCATTATTGCATCGCGTA

Reverse complement sequence

TACGCGATGCAATAATGAGCCGTATGTAGTTAATACTAGGGTGAAAACAGTACAGAAACTTTCCAAATTCCAGACCTATTTTCAAAAACGGAATATATCG[A/G]
TCGGAATTTTTTGGAAACGGAAACGAATTCGAAAATATTTTCTCGGAAACGGGATCGAAAATGATAAGGACAGTTTCCGTCGGAACTCAGAATCCGATCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.20% 16.80% 0.02% 0.00% NA
All Indica  2759 99.20% 0.80% 0.00% 0.00% NA
All Japonica  1512 51.40% 48.60% 0.00% 0.00% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 21.30% 78.70% 0.00% 0.00% NA
Tropical Japonica  504 94.80% 5.20% 0.00% 0.00% NA
Japonica Intermediate  241 56.40% 43.60% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004261816 T -> C LOC_Os10g07974.1 upstream_gene_variant ; 1412.0bp to feature; MODIFIER silent_mutation Average:52.695; most accessible tissue: Minghui63 root, score: 64.607 N N N N
vg1004261816 T -> C LOC_Os10g07978.1 upstream_gene_variant ; 699.0bp to feature; MODIFIER silent_mutation Average:52.695; most accessible tissue: Minghui63 root, score: 64.607 N N N N
vg1004261816 T -> C LOC_Os10g07978.2 upstream_gene_variant ; 699.0bp to feature; MODIFIER silent_mutation Average:52.695; most accessible tissue: Minghui63 root, score: 64.607 N N N N
vg1004261816 T -> C LOC_Os10g07974-LOC_Os10g07978 intergenic_region ; MODIFIER silent_mutation Average:52.695; most accessible tissue: Minghui63 root, score: 64.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004261816 NA 9.78E-06 Yield Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1004261816 NA 2.86E-23 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816 1.36E-07 1.14E-38 mr1310 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816 NA 1.30E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816 NA 1.97E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816 NA 1.91E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816 9.22E-11 3.64E-24 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816 2.72E-06 1.37E-07 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816 7.02E-06 1.35E-39 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816 NA 1.22E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816 NA 4.42E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816 NA 8.29E-14 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816 4.23E-06 1.38E-33 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816 NA 3.67E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816 NA 1.61E-07 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816 6.19E-07 1.86E-28 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816 NA 9.51E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816 4.21E-06 2.22E-16 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004261816 NA 5.89E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251