\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004032949:

Variant ID: vg1004032949 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4032949
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:


GGGATCTGAAACGCCATGCGATGACACCGACAAGCTACTGTTCGTAGCAGCAGCAACAATACAAATTGGTGATGGGGCAAACGCGAAATTCTGGGACTCC[G/A]
CTTGGCTAAAGGGAGAAGGCTGAAGGATATTGCCCCCGCTAGTCTATGCGATTTCCAAGAAGAAGAGCACTGCTCTCCAACAAGCCGCTCTTGTGGACCA

Reverse complement sequence

TGGTCCACAAGAGCGGCTTGTTGGAGAGCAGTGCTCTTCTTCTTGGAAATCGCATAGACTAGCGGGGGCAATATCCTTCAGCCTTCTCCCTTTAGCCAAG[C/T]
GGAGTCCCAGAATTTCGCGTTTGCCCCATCACCAATTTGTATTGTTGCTGCTGCTACGAACAGTAGCTTGTCGGTGTCATCGCATGGCGTTTCAGATCCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.00% 7.30% 2.54% 1.25% NA
All Indica  2759 89.90% 5.50% 3.23% 1.34% NA
All Japonica  1512 85.00% 11.60% 2.05% 1.39% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 94.60% 0.00% 4.54% 0.84% NA
Indica II  465 83.40% 12.30% 3.44% 0.86% NA
Indica III  913 89.00% 7.70% 1.64% 1.64% NA
Indica Intermediate  786 91.20% 3.20% 3.94% 1.65% NA
Temperate Japonica  767 92.70% 7.00% 0.13% 0.13% NA
Tropical Japonica  504 78.60% 11.90% 5.75% 3.77% NA
Japonica Intermediate  241 73.90% 25.30% 0.41% 0.41% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004032949 G -> A LOC_Os10g07534.1 downstream_gene_variant ; 3254.0bp to feature; MODIFIER silent_mutation Average:64.669; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N
vg1004032949 G -> A LOC_Os10g07536.1 downstream_gene_variant ; 177.0bp to feature; MODIFIER silent_mutation Average:64.669; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N
vg1004032949 G -> A LOC_Os10g07538.1 downstream_gene_variant ; 1726.0bp to feature; MODIFIER silent_mutation Average:64.669; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N
vg1004032949 G -> A LOC_Os10g07536-LOC_Os10g07538 intergenic_region ; MODIFIER silent_mutation Average:64.669; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N
vg1004032949 G -> DEL N N silent_mutation Average:64.669; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004032949 NA 6.69E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004032949 8.39E-06 8.39E-06 mr1493 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004032949 NA 4.49E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004032949 8.18E-07 NA mr1706 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004032949 NA 1.23E-09 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251