\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004001379:

Variant ID: vg1004001379 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4001379
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCACTGGGCCCCACCTAGGGGCGGTCGACCGCCTTGCTTCCGGTTGAAGGTATGGACGGTAGCTTGCCCCAGGCTATGTGGGTCCCCTCCAATAGGGAA[A/G,T]
TAGGTAAAGACGGTGCATGTGGTATCCCCTTGAACTATAAAAGGAAGACCTTACCCACCGAGAAAGGGGACGACTCTTGATAGCTTGGGCTCTAGGGTTT

Reverse complement sequence

AAACCCTAGAGCCCAAGCTATCAAGAGTCGTCCCCTTTCTCGGTGGGTAAGGTCTTCCTTTTATAGTTCAAGGGGATACCACATGCACCGTCTTTACCTA[T/C,A]
TTCCCTATTGGAGGGGACCCACATAGCCTGGGGCAAGCTACCGTCCATACCTTCAACCGGAAGCAAGGCGGTCGACCGCCCCTAGGTGGGGCCCAGTGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.00% 18.90% 0.06% 0.00% T: 0.08%
All Indica  2759 98.80% 1.10% 0.04% 0.00% T: 0.14%
All Japonica  1512 45.60% 54.30% 0.13% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 98.20% 1.70% 0.17% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 98.90% 0.70% 0.00% 0.00% T: 0.44%
Indica Intermediate  786 98.60% 1.40% 0.00% 0.00% NA
Temperate Japonica  767 12.60% 87.20% 0.13% 0.00% NA
Tropical Japonica  504 94.00% 6.00% 0.00% 0.00% NA
Japonica Intermediate  241 49.00% 50.60% 0.41% 0.00% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004001379 A -> G LOC_Os10g07520.1 downstream_gene_variant ; 3129.0bp to feature; MODIFIER silent_mutation Average:68.295; most accessible tissue: Minghui63 young leaf, score: 79.896 N N N N
vg1004001379 A -> G LOC_Os10g07510-LOC_Os10g07520 intergenic_region ; MODIFIER silent_mutation Average:68.295; most accessible tissue: Minghui63 young leaf, score: 79.896 N N N N
vg1004001379 A -> T LOC_Os10g07520.1 downstream_gene_variant ; 3129.0bp to feature; MODIFIER silent_mutation Average:68.295; most accessible tissue: Minghui63 young leaf, score: 79.896 N N N N
vg1004001379 A -> T LOC_Os10g07510-LOC_Os10g07520 intergenic_region ; MODIFIER silent_mutation Average:68.295; most accessible tissue: Minghui63 young leaf, score: 79.896 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004001379 NA 1.38E-08 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 NA 3.09E-36 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 NA 3.35E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 NA 1.13E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 NA 3.02E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 NA 4.98E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 NA 1.47E-21 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 NA 5.25E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 6.29E-11 2.45E-25 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 NA 1.75E-07 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 NA 4.08E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 NA 1.67E-09 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 NA 4.19E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 NA 6.71E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 NA 1.30E-32 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 NA 3.81E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 8.95E-07 NA mr1563_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 NA 1.23E-07 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 3.17E-07 5.03E-32 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 NA 4.71E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004001379 NA 1.74E-15 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251